ID: 1019316684

View in Genome Browser
Species Human (GRCh38)
Location 7:390245-390267
Sequence ACAGCCCTGCGTGTGCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019316684_1019316693 19 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316693 7:390287-390309 CCAGGAAGGGAGACACAAGGCGG No data
1019316684_1019316691 16 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316691 7:390284-390306 AGACCAGGAAGGGAGACACAAGG No data
1019316684_1019316695 30 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316695 7:390298-390320 GACACAAGGCGGAAGGCGTGAGG No data
1019316684_1019316689 5 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316689 7:390273-390295 CAGGGAGAGACAGACCAGGAAGG No data
1019316684_1019316694 23 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316694 7:390291-390313 GAAGGGAGACACAAGGCGGAAGG No data
1019316684_1019316688 1 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316688 7:390269-390291 TTCTCAGGGAGAGACAGACCAGG No data
1019316684_1019316690 6 Left 1019316684 7:390245-390267 CCTCCGGGCACACGCAGGGCTGT No data
Right 1019316690 7:390274-390296 AGGGAGAGACAGACCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019316684 Original CRISPR ACAGCCCTGCGTGTGCCCGG AGG (reversed) Intergenic
No off target data available for this crispr