ID: 1019317137

View in Genome Browser
Species Human (GRCh38)
Location 7:391951-391973
Sequence GTGCAGAGAGGCCCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019317137_1019317146 -1 Left 1019317137 7:391951-391973 CCCTTCCCAGGGCCTCTCTGCAC No data
Right 1019317146 7:391973-391995 CCCCTCAGGCCCCCTGGGCTTGG No data
1019317137_1019317150 7 Left 1019317137 7:391951-391973 CCCTTCCCAGGGCCTCTCTGCAC No data
Right 1019317150 7:391981-392003 GCCCCCTGGGCTTGGCACCTGGG No data
1019317137_1019317144 -6 Left 1019317137 7:391951-391973 CCCTTCCCAGGGCCTCTCTGCAC No data
Right 1019317144 7:391968-391990 CTGCACCCCTCAGGCCCCCTGGG No data
1019317137_1019317149 6 Left 1019317137 7:391951-391973 CCCTTCCCAGGGCCTCTCTGCAC No data
Right 1019317149 7:391980-392002 GGCCCCCTGGGCTTGGCACCTGG No data
1019317137_1019317143 -7 Left 1019317137 7:391951-391973 CCCTTCCCAGGGCCTCTCTGCAC No data
Right 1019317143 7:391967-391989 TCTGCACCCCTCAGGCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019317137 Original CRISPR GTGCAGAGAGGCCCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr