ID: 1019317953

View in Genome Browser
Species Human (GRCh38)
Location 7:399923-399945
Sequence CTGCTGTATCTCCTCCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019317948_1019317953 13 Left 1019317948 7:399887-399909 CCTAAGAACTCAGCCACTGTGGT No data
Right 1019317953 7:399923-399945 CTGCTGTATCTCCTCCACACAGG No data
1019317949_1019317953 0 Left 1019317949 7:399900-399922 CCACTGTGGTCTCCCCACACTCT No data
Right 1019317953 7:399923-399945 CTGCTGTATCTCCTCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019317953 Original CRISPR CTGCTGTATCTCCTCCACAC AGG Intergenic
No off target data available for this crispr