ID: 1019318073

View in Genome Browser
Species Human (GRCh38)
Location 7:400626-400648
Sequence CCTCCCCTAATACACCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019318073_1019318084 14 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318084 7:400663-400685 AGTCCAGGCCTGTGAGAAGGAGG No data
1019318073_1019318083 11 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318083 7:400660-400682 GGGAGTCCAGGCCTGTGAGAAGG No data
1019318073_1019318086 20 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318086 7:400669-400691 GGCCTGTGAGAAGGAGGCAGAGG No data
1019318073_1019318080 -10 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318080 7:400639-400661 TTAGGGGAGGGGGCTTCTCAAGG No data
1019318073_1019318081 -9 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318081 7:400640-400662 TAGGGGAGGGGGCTTCTCAAGGG No data
1019318073_1019318082 -1 Left 1019318073 7:400626-400648 CCACCCAGGTGTATTAGGGGAGG No data
Right 1019318082 7:400648-400670 GGGGCTTCTCAAGGGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019318073 Original CRISPR CCTCCCCTAATACACCTGGG TGG (reversed) Intergenic
No off target data available for this crispr