ID: 1019318918

View in Genome Browser
Species Human (GRCh38)
Location 7:406038-406060
Sequence CAGGGTGGTCTGGAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019318918_1019318933 16 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318933 7:406077-406099 CCTTCGCCAAGAGCTGGGGGCGG No data
1019318918_1019318928 11 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318928 7:406072-406094 ACCTGCCTTCGCCAAGAGCTGGG No data
1019318918_1019318935 18 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318935 7:406079-406101 TTCGCCAAGAGCTGGGGGCGGGG No data
1019318918_1019318930 12 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318930 7:406073-406095 CCTGCCTTCGCCAAGAGCTGGGG No data
1019318918_1019318927 10 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318927 7:406071-406093 AACCTGCCTTCGCCAAGAGCTGG No data
1019318918_1019318931 13 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318931 7:406074-406096 CTGCCTTCGCCAAGAGCTGGGGG No data
1019318918_1019318934 17 Left 1019318918 7:406038-406060 CCTCCCTCCTCCAGACCACCCTG No data
Right 1019318934 7:406078-406100 CTTCGCCAAGAGCTGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019318918 Original CRISPR CAGGGTGGTCTGGAGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr