ID: 1019320368

View in Genome Browser
Species Human (GRCh38)
Location 7:412500-412522
Sequence GCTCATACCACGCCACAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019320365_1019320368 -2 Left 1019320365 7:412479-412501 CCACGTCACACCACACCACACGC No data
Right 1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG No data
1019320361_1019320368 23 Left 1019320361 7:412454-412476 CCACGCCACAACATGGCAACCCA No data
Right 1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG No data
1019320362_1019320368 18 Left 1019320362 7:412459-412481 CCACAACATGGCAACCCACACCA No data
Right 1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG No data
1019320363_1019320368 4 Left 1019320363 7:412473-412495 CCCACACCACGTCACACCACACC No data
Right 1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG No data
1019320364_1019320368 3 Left 1019320364 7:412474-412496 CCACACCACGTCACACCACACCA No data
Right 1019320368 7:412500-412522 GCTCATACCACGCCACAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019320368 Original CRISPR GCTCATACCACGCCACAACA TGG Intergenic
No off target data available for this crispr