ID: 1019320489

View in Genome Browser
Species Human (GRCh38)
Location 7:413253-413275
Sequence GACTGCAGGCCTTGAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019320489_1019320499 1 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320499 7:413277-413299 GCCAAGGGGTCTGGGAGGGAGGG No data
1019320489_1019320498 0 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320498 7:413276-413298 TGCCAAGGGGTCTGGGAGGGAGG No data
1019320489_1019320494 -8 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320494 7:413268-413290 CTGCAGTCTGCCAAGGGGTCTGG No data
1019320489_1019320503 13 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320503 7:413289-413311 GGGAGGGAGGGGGATTTTGAAGG No data
1019320489_1019320501 2 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320501 7:413278-413300 CCAAGGGGTCTGGGAGGGAGGGG No data
1019320489_1019320505 29 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320505 7:413305-413327 TTGAAGGAGCCCTTGGATGACGG No data
1019320489_1019320504 22 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320504 7:413298-413320 GGGGATTTTGAAGGAGCCCTTGG No data
1019320489_1019320496 -4 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320496 7:413272-413294 AGTCTGCCAAGGGGTCTGGGAGG No data
1019320489_1019320497 -3 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320497 7:413273-413295 GTCTGCCAAGGGGTCTGGGAGGG No data
1019320489_1019320495 -7 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320495 7:413269-413291 TGCAGTCTGCCAAGGGGTCTGGG No data
1019320489_1019320502 3 Left 1019320489 7:413253-413275 CCAGATGCTCAAGGCCTGCAGTC No data
Right 1019320502 7:413279-413301 CAAGGGGTCTGGGAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019320489 Original CRISPR GACTGCAGGCCTTGAGCATC TGG (reversed) Intergenic
No off target data available for this crispr