ID: 1019322671

View in Genome Browser
Species Human (GRCh38)
Location 7:422765-422787
Sequence GTCTGATGCTGGGAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019322671_1019322689 27 Left 1019322671 7:422765-422787 CCCCAACACTCCCAGCATCAGAC No data
Right 1019322689 7:422815-422837 CCCAGCATCGGATGGAACCCGGG No data
1019322671_1019322686 19 Left 1019322671 7:422765-422787 CCCCAACACTCCCAGCATCAGAC No data
Right 1019322686 7:422807-422829 CCAACACGCCCAGCATCGGATGG No data
1019322671_1019322681 15 Left 1019322671 7:422765-422787 CCCCAACACTCCCAGCATCAGAC No data
Right 1019322681 7:422803-422825 TCCCCCAACACGCCCAGCATCGG No data
1019322671_1019322687 26 Left 1019322671 7:422765-422787 CCCCAACACTCCCAGCATCAGAC No data
Right 1019322687 7:422814-422836 GCCCAGCATCGGATGGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019322671 Original CRISPR GTCTGATGCTGGGAGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr