ID: 1019322777

View in Genome Browser
Species Human (GRCh38)
Location 7:423104-423126
Sequence TAGGAGAAGCACGAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019322767_1019322777 -1 Left 1019322767 7:423082-423104 CCTCCAGACCCTCCTTGAATTTT No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data
1019322763_1019322777 30 Left 1019322763 7:423051-423073 CCAGGCCAGGTTTCAGGCTGGGA No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data
1019322768_1019322777 -4 Left 1019322768 7:423085-423107 CCAGACCCTCCTTGAATTTTAGG No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data
1019322764_1019322777 25 Left 1019322764 7:423056-423078 CCAGGTTTCAGGCTGGGATTAAG No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data
1019322771_1019322777 -10 Left 1019322771 7:423091-423113 CCTCCTTGAATTTTAGGAGAAGC No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data
1019322770_1019322777 -9 Left 1019322770 7:423090-423112 CCCTCCTTGAATTTTAGGAGAAG No data
Right 1019322777 7:423104-423126 TAGGAGAAGCACGAAGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019322777 Original CRISPR TAGGAGAAGCACGAAGGGGT GGG Intergenic
No off target data available for this crispr