ID: 1019323972

View in Genome Browser
Species Human (GRCh38)
Location 7:428973-428995
Sequence CGGTGTCTGCAGGATCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019323962_1019323972 16 Left 1019323962 7:428934-428956 CCAGGGGAAGACCATTCCCTTAC No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323970_1019323972 -9 Left 1019323970 7:428959-428981 CCTGGTGAGAGGCGCGGTGTCTG No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323966_1019323972 0 Left 1019323966 7:428950-428972 CCCTTACTCCCTGGTGAGAGGCG No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323969_1019323972 -8 Left 1019323969 7:428958-428980 CCCTGGTGAGAGGCGCGGTGTCT No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323964_1019323972 5 Left 1019323964 7:428945-428967 CCATTCCCTTACTCCCTGGTGAG No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323967_1019323972 -1 Left 1019323967 7:428951-428973 CCTTACTCCCTGGTGAGAGGCGC No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data
1019323961_1019323972 17 Left 1019323961 7:428933-428955 CCCAGGGGAAGACCATTCCCTTA No data
Right 1019323972 7:428973-428995 CGGTGTCTGCAGGATCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019323972 Original CRISPR CGGTGTCTGCAGGATCTACA AGG Intergenic
No off target data available for this crispr