ID: 1019324697

View in Genome Browser
Species Human (GRCh38)
Location 7:432363-432385
Sequence GAGGCTCAGCCTCGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019324685_1019324697 29 Left 1019324685 7:432311-432333 CCAGGAGACTGGCCGGGGCAGCC No data
Right 1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG No data
1019324687_1019324697 17 Left 1019324687 7:432323-432345 CCGGGGCAGCCATCATAGGCAGG No data
Right 1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG No data
1019324689_1019324697 8 Left 1019324689 7:432332-432354 CCATCATAGGCAGGTGTGTGTGG No data
Right 1019324697 7:432363-432385 GAGGCTCAGCCTCGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019324697 Original CRISPR GAGGCTCAGCCTCGGGACAC AGG Intergenic
No off target data available for this crispr