ID: 1019324884

View in Genome Browser
Species Human (GRCh38)
Location 7:433142-433164
Sequence TGGCTCCTACCAGAAAGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019324884_1019324892 28 Left 1019324884 7:433142-433164 CCCGCACTTTCTGGTAGGAGCCA No data
Right 1019324892 7:433193-433215 TGACCTCAATCAGTCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019324884 Original CRISPR TGGCTCCTACCAGAAAGTGC GGG (reversed) Intergenic
No off target data available for this crispr