ID: 1019325225

View in Genome Browser
Species Human (GRCh38)
Location 7:434862-434884
Sequence AACGGCTGCTCTTCCCCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019325225_1019325228 19 Left 1019325225 7:434862-434884 CCGGATGGGGAAGAGCAGCCGTT No data
Right 1019325228 7:434904-434926 AAATCGAACACTGCTGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019325225 Original CRISPR AACGGCTGCTCTTCCCCATC CGG (reversed) Intergenic
No off target data available for this crispr