ID: 1019327525

View in Genome Browser
Species Human (GRCh38)
Location 7:445689-445711
Sequence GCCCGCAGTGGGGAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019327525_1019327536 4 Left 1019327525 7:445689-445711 CCTGCCCCTTCCCCACTGCGGGC No data
Right 1019327536 7:445716-445738 GCCCAGGTCCGGACTTGTTGAGG No data
1019327525_1019327542 30 Left 1019327525 7:445689-445711 CCTGCCCCTTCCCCACTGCGGGC No data
Right 1019327542 7:445742-445764 CACCTCCTCCACGGCCACAGCGG No data
1019327525_1019327535 -7 Left 1019327525 7:445689-445711 CCTGCCCCTTCCCCACTGCGGGC No data
Right 1019327535 7:445705-445727 TGCGGGCTTGGGCCCAGGTCCGG No data
1019327525_1019327540 21 Left 1019327525 7:445689-445711 CCTGCCCCTTCCCCACTGCGGGC No data
Right 1019327540 7:445733-445755 TTGAGGCCTCACCTCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019327525 Original CRISPR GCCCGCAGTGGGGAAGGGGC AGG (reversed) Intergenic