ID: 1019328869

View in Genome Browser
Species Human (GRCh38)
Location 7:452974-452996
Sequence GGGAATTCCCATCCGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019328864_1019328869 -2 Left 1019328864 7:452953-452975 CCAGCGAGCTGGGGGTTGGAGGG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328851_1019328869 22 Left 1019328851 7:452929-452951 CCTCCTGCAGGCCGGCCCAGGGC No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328862_1019328869 -1 Left 1019328862 7:452952-452974 CCCAGCGAGCTGGGGGTTGGAGG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328853_1019328869 11 Left 1019328853 7:452940-452962 CCGGCCCAGGGCCCCAGCGAGCT No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328861_1019328869 0 Left 1019328861 7:452951-452973 CCCCAGCGAGCTGGGGGTTGGAG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328858_1019328869 6 Left 1019328858 7:452945-452967 CCAGGGCCCCAGCGAGCTGGGGG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328849_1019328869 23 Left 1019328849 7:452928-452950 CCCTCCTGCAGGCCGGCCCAGGG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328852_1019328869 19 Left 1019328852 7:452932-452954 CCTGCAGGCCGGCCCAGGGCCCC No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data
1019328856_1019328869 7 Left 1019328856 7:452944-452966 CCCAGGGCCCCAGCGAGCTGGGG No data
Right 1019328869 7:452974-452996 GGGAATTCCCATCCGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019328869 Original CRISPR GGGAATTCCCATCCGCAGGG AGG Intergenic
No off target data available for this crispr