ID: 1019329434

View in Genome Browser
Species Human (GRCh38)
Location 7:455373-455395
Sequence CGTTGTATCCACGTGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019329434_1019329443 9 Left 1019329434 7:455373-455395 CCCATCTCCACGTGGATACAACG No data
Right 1019329443 7:455405-455427 CCACCTGAACCCGAGGCCATGGG No data
1019329434_1019329441 8 Left 1019329434 7:455373-455395 CCCATCTCCACGTGGATACAACG No data
Right 1019329441 7:455404-455426 TCCACCTGAACCCGAGGCCATGG No data
1019329434_1019329440 2 Left 1019329434 7:455373-455395 CCCATCTCCACGTGGATACAACG No data
Right 1019329440 7:455398-455420 GCAGCATCCACCTGAACCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019329434 Original CRISPR CGTTGTATCCACGTGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr