ID: 1019331019

View in Genome Browser
Species Human (GRCh38)
Location 7:460864-460886
Sequence CAAGCACCTCCCACTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019331012_1019331019 20 Left 1019331012 7:460821-460843 CCAGGATTTAAACACAGGCTTCC No data
Right 1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG No data
1019331016_1019331019 -1 Left 1019331016 7:460842-460864 CCTGACTTCTAGGCTAGGGTTTC No data
Right 1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019331019 Original CRISPR CAAGCACCTCCCACTCAAAG GGG Intergenic
No off target data available for this crispr