ID: 1019331289

View in Genome Browser
Species Human (GRCh38)
Location 7:462058-462080
Sequence CTGGACCCACACATGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019331278_1019331289 16 Left 1019331278 7:462019-462041 CCTGCTGATACTTGGGGCGCAGG No data
Right 1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG No data
1019331277_1019331289 17 Left 1019331277 7:462018-462040 CCCTGCTGATACTTGGGGCGCAG No data
Right 1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019331289 Original CRISPR CTGGACCCACACATGGGAAA GGG Intergenic
No off target data available for this crispr