ID: 1019332018

View in Genome Browser
Species Human (GRCh38)
Location 7:464911-464933
Sequence TTTCCAGCAGATCCGTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019332017_1019332018 -7 Left 1019332017 7:464895-464917 CCTGGGGGAGGCTGAGTTTCCAG No data
Right 1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG No data
1019332002_1019332018 30 Left 1019332002 7:464858-464880 CCCTGCAGAGTGGACTCAGGTCA No data
Right 1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG No data
1019332016_1019332018 2 Left 1019332016 7:464886-464908 CCTGGGGGGCCTGGGGGAGGCTG No data
Right 1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG No data
1019332003_1019332018 29 Left 1019332003 7:464859-464881 CCTGCAGAGTGGACTCAGGTCAT No data
Right 1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG No data
1019332015_1019332018 3 Left 1019332015 7:464885-464907 CCCTGGGGGGCCTGGGGGAGGCT No data
Right 1019332018 7:464911-464933 TTTCCAGCAGATCCGTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019332018 Original CRISPR TTTCCAGCAGATCCGTCCTC AGG Intergenic
No off target data available for this crispr