ID: 1019334656

View in Genome Browser
Species Human (GRCh38)
Location 7:477236-477258
Sequence AGCCCCTGAGACGCGCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019334656_1019334667 29 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334667 7:477288-477310 GAGGAGCCTGCATGCGAGGCTGG No data
1019334656_1019334666 25 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334666 7:477284-477306 CGTGGAGGAGCCTGCATGCGAGG No data
1019334656_1019334668 30 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334668 7:477289-477311 AGGAGCCTGCATGCGAGGCTGGG No data
1019334656_1019334658 7 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334658 7:477266-477288 ACCCTCCGCCACGGCCACCGTGG No data
1019334656_1019334657 -2 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334657 7:477257-477279 CTACGTGAGACCCTCCGCCACGG No data
1019334656_1019334661 10 Left 1019334656 7:477236-477258 CCTGGGCGCGCGTCTCAGGGGCT No data
Right 1019334661 7:477269-477291 CTCCGCCACGGCCACCGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019334656 Original CRISPR AGCCCCTGAGACGCGCGCCC AGG (reversed) Intergenic