ID: 1019335337

View in Genome Browser
Species Human (GRCh38)
Location 7:480105-480127
Sequence GCTTTCTAGGAAGGGAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019335337_1019335351 28 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335351 7:480156-480178 GGAGCGTCAGGAAAGGAGTGTGG No data
1019335337_1019335352 29 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335352 7:480157-480179 GAGCGTCAGGAAAGGAGTGTGGG No data
1019335337_1019335348 16 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335348 7:480144-480166 AGCCTTGAAATCGGAGCGTCAGG No data
1019335337_1019335347 7 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335347 7:480135-480157 TCTAAGAGAAGCCTTGAAATCGG No data
1019335337_1019335350 21 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335350 7:480149-480171 TGAAATCGGAGCGTCAGGAAAGG No data
1019335337_1019335353 30 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019335337 Original CRISPR GCTTTCTAGGAAGGGAGGTT GGG (reversed) Intergenic
No off target data available for this crispr