ID: 1019335346

View in Genome Browser
Species Human (GRCh38)
Location 7:480132-480154
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019335346_1019335352 2 Left 1019335346 7:480132-480154 CCATCTAAGAGAAGCCTTGAAAT No data
Right 1019335352 7:480157-480179 GAGCGTCAGGAAAGGAGTGTGGG No data
1019335346_1019335351 1 Left 1019335346 7:480132-480154 CCATCTAAGAGAAGCCTTGAAAT No data
Right 1019335351 7:480156-480178 GGAGCGTCAGGAAAGGAGTGTGG No data
1019335346_1019335353 3 Left 1019335346 7:480132-480154 CCATCTAAGAGAAGCCTTGAAAT No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335346_1019335350 -6 Left 1019335346 7:480132-480154 CCATCTAAGAGAAGCCTTGAAAT No data
Right 1019335350 7:480149-480171 TGAAATCGGAGCGTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019335346 Original CRISPR ATTTCAAGGCTTCTCTTAGA TGG (reversed) Intergenic
No off target data available for this crispr