ID: 1019335353

View in Genome Browser
Species Human (GRCh38)
Location 7:480158-480180
Sequence AGCGTCAGGAAAGGAGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019335341_1019335353 22 Left 1019335341 7:480113-480135 CCCTTCCTAGAAAGCGGCCCCAT No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335337_1019335353 30 Left 1019335337 7:480105-480127 CCCAACCTCCCTTCCTAGAAAGC No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335342_1019335353 21 Left 1019335342 7:480114-480136 CCTTCCTAGAAAGCGGCCCCATC No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335346_1019335353 3 Left 1019335346 7:480132-480154 CCATCTAAGAGAAGCCTTGAAAT No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335338_1019335353 29 Left 1019335338 7:480106-480128 CCAACCTCCCTTCCTAGAAAGCG No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335345_1019335353 4 Left 1019335345 7:480131-480153 CCCATCTAAGAGAAGCCTTGAAA No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335343_1019335353 17 Left 1019335343 7:480118-480140 CCTAGAAAGCGGCCCCATCTAAG No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335344_1019335353 5 Left 1019335344 7:480130-480152 CCCCATCTAAGAGAAGCCTTGAA No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data
1019335340_1019335353 25 Left 1019335340 7:480110-480132 CCTCCCTTCCTAGAAAGCGGCCC No data
Right 1019335353 7:480158-480180 AGCGTCAGGAAAGGAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019335353 Original CRISPR AGCGTCAGGAAAGGAGTGTG GGG Intergenic
No off target data available for this crispr