ID: 1019335389

View in Genome Browser
Species Human (GRCh38)
Location 7:480312-480334
Sequence GGCAAGAGCCCTGGGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019335381_1019335389 -6 Left 1019335381 7:480295-480317 CCGGTGAAACGGCCGAGGGCAAG No data
Right 1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG No data
1019335376_1019335389 19 Left 1019335376 7:480270-480292 CCGAGCTTGTGAGCACTTGTGTG No data
Right 1019335389 7:480312-480334 GGCAAGAGCCCTGGGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019335389 Original CRISPR GGCAAGAGCCCTGGGGGGCA GGG Intergenic
No off target data available for this crispr