ID: 1019335605

View in Genome Browser
Species Human (GRCh38)
Location 7:481155-481177
Sequence CAGTGCCAGGCTTCGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019335605_1019335612 2 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335612 7:481180-481202 CTTCCTCTCCCCTCAGGCCATGG No data
1019335605_1019335610 -4 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335610 7:481174-481196 ACTGTCCTTCCTCTCCCCTCAGG No data
1019335605_1019335621 25 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335621 7:481203-481225 GCTCCCATGGAAATCAGGCCAGG No data
1019335605_1019335620 20 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335620 7:481198-481220 CATGGGCTCCCATGGAAATCAGG No data
1019335605_1019335613 3 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335613 7:481181-481203 TTCCTCTCCCCTCAGGCCATGGG No data
1019335605_1019335618 12 Left 1019335605 7:481155-481177 CCCCTCTCCGAAGCCTGGCACTG No data
Right 1019335618 7:481190-481212 CCTCAGGCCATGGGCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019335605 Original CRISPR CAGTGCCAGGCTTCGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr