ID: 1019336037

View in Genome Browser
Species Human (GRCh38)
Location 7:483297-483319
Sequence CCCGCCCGCCCAATATCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336037_1019336048 26 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336048 7:483346-483368 GACAAAGGGGCTGCACAACATGG No data
1019336037_1019336045 12 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336045 7:483332-483354 GCCTCGGTATCATGGACAAAGGG No data
1019336037_1019336044 11 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336044 7:483331-483353 AGCCTCGGTATCATGGACAAAGG No data
1019336037_1019336049 27 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336049 7:483347-483369 ACAAAGGGGCTGCACAACATGGG No data
1019336037_1019336043 4 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336043 7:483324-483346 AAGGGACAGCCTCGGTATCATGG No data
1019336037_1019336047 13 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336047 7:483333-483355 CCTCGGTATCATGGACAAAGGGG No data
1019336037_1019336050 30 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336050 7:483350-483372 AAGGGGCTGCACAACATGGGTGG No data
1019336037_1019336042 -4 Left 1019336037 7:483297-483319 CCGTGGGATATTGGGCGGGCGGG No data
Right 1019336042 7:483316-483338 CGGGGATAAAGGGACAGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336037 Original CRISPR CCCGCCCGCCCAATATCCCA CGG (reversed) Intergenic
No off target data available for this crispr