ID: 1019336493

View in Genome Browser
Species Human (GRCh38)
Location 7:485312-485334
Sequence GACAGGGACCCATCAAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336493_1019336502 9 Left 1019336493 7:485312-485334 CCCACCTTTGATGGGTCCCTGTC No data
Right 1019336502 7:485344-485366 AGCCCATAGAGACATCACACGGG No data
1019336493_1019336505 22 Left 1019336493 7:485312-485334 CCCACCTTTGATGGGTCCCTGTC No data
Right 1019336505 7:485357-485379 ATCACACGGGAAGATCCTGCAGG No data
1019336493_1019336501 8 Left 1019336493 7:485312-485334 CCCACCTTTGATGGGTCCCTGTC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336493 Original CRISPR GACAGGGACCCATCAAAGGT GGG (reversed) Intergenic
No off target data available for this crispr