ID: 1019336494

View in Genome Browser
Species Human (GRCh38)
Location 7:485313-485335
Sequence GGACAGGGACCCATCAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336494_1019336501 7 Left 1019336494 7:485313-485335 CCACCTTTGATGGGTCCCTGTCC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336494_1019336502 8 Left 1019336494 7:485313-485335 CCACCTTTGATGGGTCCCTGTCC No data
Right 1019336502 7:485344-485366 AGCCCATAGAGACATCACACGGG No data
1019336494_1019336505 21 Left 1019336494 7:485313-485335 CCACCTTTGATGGGTCCCTGTCC No data
Right 1019336505 7:485357-485379 ATCACACGGGAAGATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336494 Original CRISPR GGACAGGGACCCATCAAAGG TGG (reversed) Intergenic
No off target data available for this crispr