ID: 1019336499

View in Genome Browser
Species Human (GRCh38)
Location 7:485334-485356
Sequence GTCTCTATGGGCTTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336499_1019336505 0 Left 1019336499 7:485334-485356 CCCAGGAGAAAGCCCATAGAGAC No data
Right 1019336505 7:485357-485379 ATCACACGGGAAGATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336499 Original CRISPR GTCTCTATGGGCTTTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr