ID: 1019336500

View in Genome Browser
Species Human (GRCh38)
Location 7:485335-485357
Sequence TGTCTCTATGGGCTTTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336500_1019336505 -1 Left 1019336500 7:485335-485357 CCAGGAGAAAGCCCATAGAGACA No data
Right 1019336505 7:485357-485379 ATCACACGGGAAGATCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336500 Original CRISPR TGTCTCTATGGGCTTTCTCC TGG (reversed) Intergenic
No off target data available for this crispr