ID: 1019336501

View in Genome Browser
Species Human (GRCh38)
Location 7:485343-485365
Sequence AAGCCCATAGAGACATCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019336486_1019336501 20 Left 1019336486 7:485300-485322 CCACCCTCCCTTCCCACCTTTGA No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336498_1019336501 -9 Left 1019336498 7:485329-485351 CCTGTCCCAGGAGAAAGCCCATA No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336485_1019336501 30 Left 1019336485 7:485290-485312 CCGGACAGCACCACCCTCCCTTC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336494_1019336501 7 Left 1019336494 7:485313-485335 CCACCTTTGATGGGTCCCTGTCC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336493_1019336501 8 Left 1019336493 7:485312-485334 CCCACCTTTGATGGGTCCCTGTC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336497_1019336501 -8 Left 1019336497 7:485328-485350 CCCTGTCCCAGGAGAAAGCCCAT No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336489_1019336501 16 Left 1019336489 7:485304-485326 CCTCCCTTCCCACCTTTGATGGG No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336491_1019336501 13 Left 1019336491 7:485307-485329 CCCTTCCCACCTTTGATGGGTCC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336495_1019336501 4 Left 1019336495 7:485316-485338 CCTTTGATGGGTCCCTGTCCCAG No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336492_1019336501 12 Left 1019336492 7:485308-485330 CCTTCCCACCTTTGATGGGTCCC No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data
1019336487_1019336501 17 Left 1019336487 7:485303-485325 CCCTCCCTTCCCACCTTTGATGG No data
Right 1019336501 7:485343-485365 AAGCCCATAGAGACATCACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019336501 Original CRISPR AAGCCCATAGAGACATCACA CGG Intergenic
No off target data available for this crispr