ID: 1019337333

View in Genome Browser
Species Human (GRCh38)
Location 7:491629-491651
Sequence CCTGGACTCCCACCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337333_1019337344 16 Left 1019337333 7:491629-491651 CCAGGCCAGGGTGGGAGTCCAGG No data
Right 1019337344 7:491668-491690 GCTTGCTGCAGTCACCTTTGAGG No data
1019337333_1019337346 26 Left 1019337333 7:491629-491651 CCAGGCCAGGGTGGGAGTCCAGG No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337333_1019337345 25 Left 1019337333 7:491629-491651 CCAGGCCAGGGTGGGAGTCCAGG No data
Right 1019337345 7:491677-491699 AGTCACCTTTGAGGCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337333 Original CRISPR CCTGGACTCCCACCCTGGCC TGG (reversed) Intergenic