ID: 1019337338

View in Genome Browser
Species Human (GRCh38)
Location 7:491634-491656
Sequence TGCCCCCTGGACTCCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337338_1019337346 21 Left 1019337338 7:491634-491656 CCAGGGTGGGAGTCCAGGGGGCA No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337338_1019337344 11 Left 1019337338 7:491634-491656 CCAGGGTGGGAGTCCAGGGGGCA No data
Right 1019337344 7:491668-491690 GCTTGCTGCAGTCACCTTTGAGG No data
1019337338_1019337345 20 Left 1019337338 7:491634-491656 CCAGGGTGGGAGTCCAGGGGGCA No data
Right 1019337345 7:491677-491699 AGTCACCTTTGAGGCCCCGCTGG No data
1019337338_1019337348 27 Left 1019337338 7:491634-491656 CCAGGGTGGGAGTCCAGGGGGCA No data
Right 1019337348 7:491684-491706 TTTGAGGCCCCGCTGGGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337338 Original CRISPR TGCCCCCTGGACTCCCACCC TGG (reversed) Intergenic