ID: 1019337340

View in Genome Browser
Species Human (GRCh38)
Location 7:491647-491669
Sequence GCGGGAGTTGGCCTGCCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337340_1019337346 8 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337340_1019337353 28 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337353 7:491698-491720 GGGTCCCGGCTCCCACCCCAGGG No data
1019337340_1019337345 7 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337345 7:491677-491699 AGTCACCTTTGAGGCCCCGCTGG No data
1019337340_1019337352 27 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337352 7:491697-491719 TGGGTCCCGGCTCCCACCCCAGG No data
1019337340_1019337348 14 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337348 7:491684-491706 TTTGAGGCCCCGCTGGGTCCCGG No data
1019337340_1019337344 -2 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337344 7:491668-491690 GCTTGCTGCAGTCACCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337340 Original CRISPR GCGGGAGTTGGCCTGCCCCC TGG (reversed) Intergenic