ID: 1019337341

View in Genome Browser
Species Human (GRCh38)
Location 7:491659-491681
Sequence TGACTGCAGCAAGCGGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337341_1019337353 16 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337353 7:491698-491720 GGGTCCCGGCTCCCACCCCAGGG No data
1019337341_1019337356 23 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337356 7:491705-491727 GGCTCCCACCCCAGGGAGAACGG No data
1019337341_1019337345 -5 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337345 7:491677-491699 AGTCACCTTTGAGGCCCCGCTGG No data
1019337341_1019337352 15 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337352 7:491697-491719 TGGGTCCCGGCTCCCACCCCAGG No data
1019337341_1019337348 2 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337348 7:491684-491706 TTTGAGGCCCCGCTGGGTCCCGG No data
1019337341_1019337357 24 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337357 7:491706-491728 GCTCCCACCCCAGGGAGAACGGG No data
1019337341_1019337346 -4 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337341 Original CRISPR TGACTGCAGCAAGCGGGAGT TGG (reversed) Intergenic