ID: 1019337342

View in Genome Browser
Species Human (GRCh38)
Location 7:491665-491687
Sequence CAAAGGTGACTGCAGCAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337342_1019337346 -10 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337342_1019337357 18 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337357 7:491706-491728 GCTCCCACCCCAGGGAGAACGGG No data
1019337342_1019337348 -4 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337348 7:491684-491706 TTTGAGGCCCCGCTGGGTCCCGG No data
1019337342_1019337356 17 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337356 7:491705-491727 GGCTCCCACCCCAGGGAGAACGG No data
1019337342_1019337353 10 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337353 7:491698-491720 GGGTCCCGGCTCCCACCCCAGGG No data
1019337342_1019337352 9 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337352 7:491697-491719 TGGGTCCCGGCTCCCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337342 Original CRISPR CAAAGGTGACTGCAGCAAGC GGG (reversed) Intergenic