ID: 1019337346

View in Genome Browser
Species Human (GRCh38)
Location 7:491678-491700
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337338_1019337346 21 Left 1019337338 7:491634-491656 CCAGGGTGGGAGTCCAGGGGGCA No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337341_1019337346 -4 Left 1019337341 7:491659-491681 CCAACTCCCGCTTGCTGCAGTCA No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337333_1019337346 26 Left 1019337333 7:491629-491651 CCAGGCCAGGGTGGGAGTCCAGG No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337340_1019337346 8 Left 1019337340 7:491647-491669 CCAGGGGGCAGGCCAACTCCCGC No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data
1019337342_1019337346 -10 Left 1019337342 7:491665-491687 CCCGCTTGCTGCAGTCACCTTTG No data
Right 1019337346 7:491678-491700 GTCACCTTTGAGGCCCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337346 Original CRISPR GTCACCTTTGAGGCCCCGCT GGG Intergenic
No off target data available for this crispr