ID: 1019337462

View in Genome Browser
Species Human (GRCh38)
Location 7:492115-492137
Sequence CTTGGGCTGCACCACTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019337462_1019337468 12 Left 1019337462 7:492115-492137 CCAGGGCAGTGGTGCAGCCCAAG No data
Right 1019337468 7:492150-492172 TCATCCAACATCAAACAGCTGGG No data
1019337462_1019337467 11 Left 1019337462 7:492115-492137 CCAGGGCAGTGGTGCAGCCCAAG No data
Right 1019337467 7:492149-492171 GTCATCCAACATCAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019337462 Original CRISPR CTTGGGCTGCACCACTGCCC TGG (reversed) Intergenic
No off target data available for this crispr