ID: 1019338989

View in Genome Browser
Species Human (GRCh38)
Location 7:499443-499465
Sequence ACCATGGAGTCCCACGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019338985_1019338989 9 Left 1019338985 7:499411-499433 CCTCTCTTCTAAAGAAACTATTT 0: 1
1: 1
2: 3
3: 34
4: 433
Right 1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1019338982_1019338989 27 Left 1019338982 7:499393-499415 CCCTATCTCTGAGATCCTCCTCT 0: 1
1: 0
2: 0
3: 33
4: 331
Right 1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1019338983_1019338989 26 Left 1019338983 7:499394-499416 CCTATCTCTGAGATCCTCCTCTC 0: 1
1: 0
2: 3
3: 23
4: 313
Right 1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1019338984_1019338989 12 Left 1019338984 7:499408-499430 CCTCCTCTCTTCTAAAGAAACTA 0: 1
1: 0
2: 2
3: 133
4: 8409
Right 1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019338989 Original CRISPR ACCATGGAGTCCCACGTGCC AGG Intronic
901317005 1:8316317-8316339 ATCATGGAGTCCTAAGTCCCCGG + Intergenic
902847438 1:19122933-19122955 ACCCTGGACTCTCACGTGCGTGG - Exonic
904746268 1:32713167-32713189 CCCATGGAGGCCCGCGAGCCTGG - Intergenic
908152569 1:61318328-61318350 ACCACGGATTCCAACATGCCGGG - Intronic
910988301 1:93027837-93027859 AGCATGGACTCCCACTTCCCAGG - Intergenic
912967892 1:114252117-114252139 ACCATTGAGTCCTTAGTGCCAGG + Intergenic
916736574 1:167612883-167612905 ACCATGCAGTCCTTTGTGCCTGG + Intergenic
920884303 1:209911631-209911653 AGCATGGAGTCCCACTTACCAGG + Intergenic
1064251624 10:13710513-13710535 ACCATGGAGTCCCGGCTCCCAGG + Intronic
1070089402 10:73270006-73270028 ACCATGGAGTTTCAGGTGCAAGG + Intronic
1073925619 10:108511767-108511789 ACCTTGGCCTCCCAAGTGCCGGG - Intergenic
1075093085 10:119454250-119454272 ACCATGGAGTCTCACAGACCCGG + Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1076063598 10:127431206-127431228 GCCGTGGAGTCCCACCTCCCAGG + Intronic
1077094655 11:794215-794237 ACCATGGCATCCCACGCACCAGG + Intronic
1077184347 11:1229637-1229659 ACCTTGGTGTCCCCCGTGCATGG + Intronic
1077542320 11:3152848-3152870 ATCATGGAATACCACGTGCCAGG + Intronic
1079123177 11:17699422-17699444 ACCATGGGGCCCCAAGTGGCAGG + Intergenic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1084147889 11:67274778-67274800 CCCTGGGAGTCCCACATGCCGGG + Intronic
1103708582 12:122894931-122894953 ACCACTGCGTCCCACGTGTCTGG - Intronic
1104327160 12:127810564-127810586 AACTTGGAGTCCCACGTTCAAGG + Intergenic
1104370196 12:128217594-128217616 AACCTGGAGTCCCATGTTCCAGG + Intergenic
1106515546 13:30450129-30450151 ACTATGGAGACCCAGGTTCCAGG + Intergenic
1112316958 13:98371353-98371375 ACCATCGAGCCGCATGTGCCTGG + Intronic
1113455936 13:110449021-110449043 ACACTGAAGTCCCACGTGCAAGG - Intronic
1113800056 13:113081590-113081612 GCCCTGGAGTGCCCCGTGCCGGG - Intronic
1113808236 13:113122271-113122293 ACCATGGCCTCCCACAGGCCAGG - Intergenic
1119249976 14:73143861-73143883 CCCATGTAGTCCCACCTGCTTGG + Intronic
1121725247 14:96142767-96142789 ACCAGTGAGACCCACCTGCCTGG - Intergenic
1123586021 15:21761363-21761385 ACCATGGAGTCACACTGACCTGG + Intergenic
1123622662 15:22203953-22203975 ACCATGGAGTCACACTGACCTGG + Intergenic
1125986020 15:44052917-44052939 ACCATGGACTCCCTCATGACAGG - Intronic
1126744942 15:51816983-51817005 ACCCTGGGGTCACACCTGCCTGG + Intergenic
1129265557 15:74391503-74391525 ACCATGGAGACCAGCCTGCCAGG - Intergenic
1132670131 16:1099094-1099116 GCCATGGTGTCCCAGGTGGCAGG + Intergenic
1132815072 16:1822001-1822023 AACATTGAGGCCAACGTGCCAGG + Intronic
1133032972 16:3020488-3020510 ACCCCGGAGTCCCGCGTACCTGG - Exonic
1134128499 16:11632586-11632608 GCCAAGGGATCCCACGTGCCAGG - Intronic
1135394455 16:22120676-22120698 ACCATGGACTCCAAGGTGACAGG - Intronic
1138663192 16:58538791-58538813 ACCATGGAGACCCATATGCCCGG + Exonic
1141388758 16:83646970-83646992 AGCCTGCAGTCCCAGGTGCCTGG - Intronic
1141979885 16:87543551-87543573 ACCAAGAAGTCCCAGGTGCGTGG + Intergenic
1142206348 16:88784945-88784967 GCCATGGAGCCGCACGTGCTCGG - Exonic
1147538507 17:41336130-41336152 ACCATGATGTCCCACCTTCCCGG + Intergenic
1152435624 17:80274521-80274543 ACCATGGAGTGCCACCTACAAGG - Intronic
1153768802 18:8399358-8399380 AGAATGGAGTCCCTCGTGCTAGG - Intronic
1157406822 18:47428731-47428753 GCCAAGGGGTCCCACGTGTCTGG - Intergenic
1159052574 18:63435256-63435278 ACCATGGAGTCTCAAGAGGCAGG - Intergenic
1161770359 19:6227546-6227568 TCCAGTGGGTCCCACGTGCCCGG + Intronic
1162341128 19:10092063-10092085 TCCCTAGAGCCCCACGTGCCTGG + Exonic
1164422135 19:28103653-28103675 ACCATGCAGTCACACGTGCTAGG - Intergenic
1164645823 19:29858262-29858284 ACCACAGAGTCCCAGGTGGCTGG + Intergenic
1167331199 19:48857429-48857451 ACCATGGAGGCCCGGGTCCCAGG + Exonic
1168677755 19:58291294-58291316 TCCATGGCTTCCCATGTGCCAGG + Intronic
925165633 2:1713969-1713991 TCCCTTGAGACCCACGTGCCTGG - Intronic
926600113 2:14833284-14833306 ATAATGGACTCCCACTTGCCAGG + Intergenic
928415696 2:31090014-31090036 TCCATGGTGTCCCAGTTGCCAGG - Intronic
930296823 2:49564810-49564832 ACCATGGAGTGTCACCTTCCTGG - Intergenic
931265877 2:60660125-60660147 ACCATAGACCACCACGTGCCAGG + Intergenic
933823996 2:86141871-86141893 ATGATGGAGTCCCAAGGGCCAGG - Exonic
938739063 2:134213875-134213897 TCCATGAAGTCCCACATGACAGG - Intronic
941894293 2:170613831-170613853 AACTTGGAGTCCCACGTTCGAGG - Intronic
946233151 2:218305128-218305150 ACAATGAAATCCCACGTGCAAGG + Intronic
1170221231 20:13944167-13944189 AGCATGGAGGCCAACGTGACTGG + Intronic
1174574217 20:51525476-51525498 CCCAAGCAGCCCCACGTGCCTGG - Intronic
1175287072 20:57844169-57844191 TCCATGGAAGCCCATGTGCCAGG - Intergenic
1175793662 20:61757884-61757906 ACCTTGGAGTCCCATGGGCTGGG + Intronic
1177189635 21:17836107-17836129 ACCAGGAAGCCCCATGTGCCTGG - Intergenic
1181221411 22:21366684-21366706 ACCATGGAGGGCCACCTGGCGGG + Intergenic
951264848 3:20552994-20553016 TCCATGGAGCCGCAGGTGCCAGG - Intergenic
957397721 3:79664443-79664465 GCTATGGACTCCCAGGTGCCTGG + Intronic
959087207 3:101864097-101864119 ACCATAGGATCCAACGTGCCTGG - Intergenic
962864421 3:139435442-139435464 ACCATGTAGTCACACAGGCCTGG + Intergenic
963573553 3:147028914-147028936 ACCATTGTGTCCCACATGCTAGG + Intergenic
969326751 4:6448624-6448646 ACCCTGGAGTCCCCAGGGCCAGG + Intronic
969680605 4:8641314-8641336 ACCATGGCCTCCCATGTGCAGGG + Intergenic
972964729 4:44495411-44495433 AACATGGAGTCCAATGTTCCAGG + Intergenic
982648274 4:158051667-158051689 ACCATGCAGTCCTCAGTGCCTGG - Intergenic
986739271 5:10691853-10691875 ACAATAGAGACCCACGTGCACGG - Intronic
989017813 5:36959980-36960002 ACCTTGGCCTCCCAAGTGCCAGG - Intronic
1000230401 5:159310521-159310543 TCCTTGGAATCCCACATGCCCGG + Intergenic
1003238023 6:4316214-4316236 ACCAGGGAGCCCCAGGAGCCAGG + Intergenic
1003987947 6:11456221-11456243 ACCATGGAATCCAACTTGCAAGG + Intergenic
1006820883 6:36893679-36893701 ACCTTGGACTCCCAAGTGCTGGG - Intronic
1012909713 6:105105086-105105108 ACCAGGGAGTCCTAAGGGCCTGG + Intronic
1013343500 6:109237672-109237694 AACGTGGAGTCCCAGATGCCCGG + Intergenic
1013420508 6:109962538-109962560 AACAAGGAGACCCATGTGCCAGG + Intergenic
1018600229 6:165530135-165530157 AACCTGGAGTCCCATGTTCCAGG - Intronic
1019338989 7:499443-499465 ACCATGGAGTCCCACGTGCCAGG + Intronic
1019437771 7:1030781-1030803 CCCAGAGAGTCCCACCTGCCCGG - Intronic
1026236004 7:68527912-68527934 CCCATGGTGTCCCACATACCAGG - Intergenic
1026966754 7:74445069-74445091 ACCTTGGCGTCCCCCGTGCCCGG - Intergenic
1028358121 7:89934264-89934286 TCCATGGAGTCTCACGTGACTGG - Intergenic
1029556889 7:101276584-101276606 AGCATGCCGTCCCACTTGCCAGG - Intergenic
1030061280 7:105623301-105623323 ACCATGGGGTCCCATGTTCTAGG + Intronic
1035342803 7:158175025-158175047 TCCGGGGAGTCCCACATGCCGGG + Intronic
1035641408 8:1187641-1187663 CTCATGGAATCTCACGTGCCCGG + Intergenic
1037120936 8:15286338-15286360 CCCATGGAGGGCCACGTGACTGG + Intergenic
1037835599 8:22213154-22213176 AAGATGGAGTCCCCCATGCCAGG - Intergenic
1039885215 8:41650473-41650495 ATCATGGAGTCCAACCTGCAGGG - Intronic
1048287627 8:133154134-133154156 ACCCTGGAGGCCCCCTTGCCAGG + Intergenic
1049454759 8:142681240-142681262 GCCATGGAGGCCCACCTGCCTGG + Intronic
1055265986 9:74497144-74497166 ACCAGGGAGTCCGAGGTGGCCGG - Intergenic
1059051250 9:110928735-110928757 ACAAAGGAGTACCACGTGCTTGG + Intronic
1059804189 9:117780940-117780962 ACCAGGCAATCCCACGTTCCTGG - Intergenic
1060734170 9:126055730-126055752 ACGATGATGCCCCACGTGCCAGG - Intergenic
1061401987 9:130373510-130373532 ACCATGGTTTCCCCAGTGCCTGG + Intronic
1062322222 9:135995908-135995930 GCCATGGTGACCCACGAGCCTGG + Intergenic
1062355100 9:136158182-136158204 TCCACGGGGTCCCACCTGCCGGG + Intergenic
1062469960 9:136697974-136697996 ACCAGGGAGTCCCACGAGACTGG + Intergenic
1185695017 X:2187542-2187564 ACAGTGGGGTCCCACTTGCCCGG - Intergenic
1196009870 X:110875379-110875401 ACCTTGGAGTCCAAGGTGACTGG + Intergenic
1198854804 X:141004592-141004614 ACCATGGAGTCACCCGTGGATGG + Intergenic
1198877210 X:141240552-141240574 ACCATGGAGTCACCCGTGGATGG - Intergenic
1198907889 X:141582773-141582795 ACCATGGAGTCACCCGTGGATGG - Intergenic
1198908902 X:141591651-141591673 ACCATGGAGTCACCCGTGGATGG + Intronic
1198918175 X:141696505-141696527 ACCATGGAGTCACCCGTGGATGG - Intronic