ID: 1019340116

View in Genome Browser
Species Human (GRCh38)
Location 7:504884-504906
Sequence GGGAGCCCACGCGCCCGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340116_1019340122 7 Left 1019340116 7:504884-504906 CCACCGCGGGCGCGTGGGCTCCC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1019340122 7:504914-504936 AACAGAAATGCCACCCCTCTGGG No data
1019340116_1019340126 21 Left 1019340116 7:504884-504906 CCACCGCGGGCGCGTGGGCTCCC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1019340126 7:504928-504950 CCCTCTGGGCACCGTGCGAAAGG 0: 1
1: 1
2: 0
3: 10
4: 58
1019340116_1019340121 6 Left 1019340116 7:504884-504906 CCACCGCGGGCGCGTGGGCTCCC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1019340121 7:504913-504935 CAACAGAAATGCCACCCCTCTGG 0: 1
1: 0
2: 0
3: 15
4: 126
1019340116_1019340128 28 Left 1019340116 7:504884-504906 CCACCGCGGGCGCGTGGGCTCCC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 1019340128 7:504935-504957 GGCACCGTGCGAAAGGCACATGG 0: 1
1: 0
2: 1
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340116 Original CRISPR GGGAGCCCACGCGCCCGCGG TGG (reversed) Intronic
900297990 1:1961918-1961940 CAGAGCCCACGCGCCCCTGGGGG + Intronic
900461978 1:2805962-2805984 GGGAGCGGACGGGACCGCGGTGG - Intergenic
901109631 1:6784915-6784937 GGGACCCCACGCGCCAGCAGCGG + Intergenic
902281368 1:15377130-15377152 GGCAGCACACGTGCCCTCGGCGG - Intronic
903063049 1:20683703-20683725 TGGAGCCCAAGCACCCGAGGAGG + Intronic
903420790 1:23217023-23217045 GGGATCCCACGCGCGCGTTGGGG - Intergenic
904236730 1:29121723-29121745 GGGAGCGCGGGCGCCGGCGGCGG + Exonic
907213447 1:52842703-52842725 GCGAGGCGACGCGCACGCGGGGG - Intronic
907278145 1:53328139-53328161 GGGAGCGCGCGCGCTGGCGGCGG - Intergenic
907905917 1:58783753-58783775 CGGTACCCACGCGCCCGCCGGGG - Exonic
918497676 1:185157552-185157574 CGGAGCCCGCGGGCCCGCGGCGG + Intronic
921599287 1:217089724-217089746 GGCCGGCCCCGCGCCCGCGGGGG - Intronic
1066023132 10:31321112-31321134 GGGAGCCCAGGCGCGGGGGGTGG - Intronic
1069909496 10:71750808-71750830 GGGAGCCAAGGCGGCCACGGGGG + Exonic
1071997705 10:91163405-91163427 GGGAGCCGCTGCTCCCGCGGCGG - Intronic
1072511425 10:96130007-96130029 GGGAGCGCACGCTGCGGCGGAGG - Intronic
1074756509 10:116627813-116627835 GGGCGCGCACACGGCCGCGGAGG + Exonic
1076767418 10:132644212-132644234 GGGAGCCCACGCCCACGCCCAGG + Intronic
1077252413 11:1566495-1566517 GGGAGCCCACTCTCCAGTGGAGG - Intronic
1083922505 11:65788200-65788222 GGGAGCCCACCCCACAGCGGAGG + Intronic
1083960344 11:66011866-66011888 GGGAGCCCAGGAGGCCGAGGGGG - Exonic
1084700819 11:70785218-70785240 GGGGGCCCAGGCGCCCCCAGGGG - Intronic
1085394682 11:76201295-76201317 GGGAGGCCACCCGCCCACAGGGG + Intronic
1092196486 12:6552582-6552604 GGGAGCCCACGAGTCCCTGGAGG + Intronic
1092256047 12:6927538-6927560 GGGAGCCCGCGGGCCCGGCGCGG - Intronic
1096431059 12:51543350-51543372 GGGAGCCCAAGCGCCTTCTGGGG + Intergenic
1097889229 12:64760285-64760307 GTGAGCCACCGCGCCCACGGTGG - Intergenic
1101144796 12:101830869-101830891 GGGAGCCCACGCCCTCGGCGCGG + Exonic
1102457188 12:113077996-113078018 CGGAGCCCGGGCGCCCCCGGCGG + Exonic
1103364010 12:120369327-120369349 GCGAGCCCGGGCGCCCGCGGAGG + Intergenic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1104961407 12:132490089-132490111 GGGCGCGCGGGCGCCCGCGGCGG + Exonic
1106264876 13:28100747-28100769 CCGAGCCCACGTGCCCGCCGCGG + Intergenic
1113655814 13:112067359-112067381 CGCAGCCCAGGCGCCCTCGGCGG - Intergenic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1122235299 14:100327807-100327829 GGGAGCCCTTGCTCCCGCAGGGG + Intronic
1122471274 14:101968370-101968392 GGGAGCCCAGGAGGCCGAGGTGG - Intronic
1122810041 14:104283289-104283311 GGGTGACCACCCGCCCACGGAGG - Intergenic
1126959755 15:53978383-53978405 GGGAGCCCGGGCGCTCTCGGTGG + Intergenic
1128616433 15:69114121-69114143 GGGAGCCCACGCCCCACAGGTGG - Intergenic
1129062254 15:72869351-72869373 GGGAGCCCAAGAGCCCGAAGTGG - Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1139465194 16:67150574-67150596 GGGAGGCCACGCCCCGGGGGGGG + Exonic
1141079208 16:81035965-81035987 GGGCACCCACGGGCCCGAGGCGG - Exonic
1142271860 16:89094007-89094029 CGGGGCCCACGGGACCGCGGCGG + Intronic
1142285502 16:89169950-89169972 GGGAGCACACCCTCCCGCAGTGG + Intergenic
1143150870 17:4807139-4807161 CGGAGCCCACGCCCCGGCCGAGG - Exonic
1146058612 17:29593265-29593287 GTGCGCCCCCGCGCCCGCTGCGG + Intronic
1148493486 17:48037856-48037878 GGGAGGCCACGCGCGAGAGGGGG - Intronic
1150790426 17:68197555-68197577 GGGAGCCCAAGGGCCGGGGGGGG - Intergenic
1152776286 17:82204063-82204085 GGGAGCCCTCGTGCCCCCAGCGG - Intronic
1152793040 17:82292558-82292580 GGACGCAGACGCGCCCGCGGCGG + Intergenic
1156296573 18:35797285-35797307 GTGAGCCCACGCGCCCGGCAAGG + Intergenic
1157006645 18:43590533-43590555 GGGAGCCCACGAGCACCCAGTGG - Intergenic
1161251829 19:3284971-3284993 GGCAGCCCGCGTGCCCGCGCTGG + Intronic
1161354471 19:3811167-3811189 GGGAGCCCACGGGGCTGAGGCGG + Intronic
1165066613 19:33232841-33232863 GGGAGACCACGCCCCAGGGGCGG - Intergenic
1167259607 19:48450964-48450986 TGAAGCCCAAGCGCCAGCGGTGG - Intronic
1168124395 19:54275650-54275672 GGGAGCCCAGGGGACCGGGGTGG + Intronic
1168414453 19:56159704-56159726 GGCAGGCCAGGCGCCAGCGGGGG - Exonic
926901214 2:17753780-17753802 GGGAGCCCCGGCGCCCACCGCGG + Exonic
927713821 2:25340920-25340942 GGGTGCCCGGGCGGCCGCGGTGG - Intronic
927964975 2:27262839-27262861 GTGAGCCCCCGGGACCGCGGTGG - Exonic
927978317 2:27357059-27357081 GGGATCCCACGCGGCCTCGACGG + Intergenic
929151149 2:38750517-38750539 GGGAGCGCGCGGGCCCGCAGCGG + Intronic
929539746 2:42810481-42810503 GGGTGCGCTGGCGCCCGCGGCGG - Intergenic
931348869 2:61470928-61470950 GGGCGCCGAGGCGCCGGCGGCGG + Intergenic
932625674 2:73293758-73293780 GGGAGCGCGCGCGCACGCAGCGG - Intergenic
935720153 2:105972745-105972767 GGGAGCCCATGGGCAGGCGGGGG + Intergenic
946414016 2:219530306-219530328 GGAAGCCCAGGCTCCCGCTGGGG - Intronic
947815202 2:233032128-233032150 GGGAGCCCACGCAGCAGCGGGGG + Intergenic
948822688 2:240557936-240557958 GGGAGCGCGGGCGTCCGCGGTGG - Exonic
948932562 2:241141518-241141540 GGGAGCCCAGGTGCCCGAGGAGG - Intronic
1169800340 20:9507094-9507116 GGGAGCCCAGGCGGCGGAGGCGG - Intergenic
1172042030 20:32052547-32052569 GGGAGCCCAGGAGCCTGGGGAGG + Intronic
1174436373 20:50510123-50510145 GAGAGCCCACGCGCCGTGGGCGG + Intergenic
1175976241 20:62711731-62711753 GAGAGCCCACGCACGCGGGGAGG - Intronic
1176062597 20:63178888-63178910 GAGCGCCCAGGCGCCCGCAGAGG + Intergenic
1179631809 21:42683552-42683574 GGCAGCCCAGGCGGCCCCGGAGG - Intronic
1179922260 21:44513649-44513671 GGGTGCCCACCCGCCCTCGAGGG - Intronic
1180949122 22:19713406-19713428 GGGAGCCCACGGGCCAGCAGAGG + Intergenic
1182494170 22:30694772-30694794 CGGAGCGCACGGGACCGCGGAGG + Intronic
959591867 3:108090796-108090818 CGCAGCCCACACGCCCGCGGGGG + Intronic
961028822 3:123584826-123584848 GGGAGCCAGCGCGGCCGGGGAGG - Intronic
964438238 3:156675505-156675527 GGGCGCCCAGGCGCCTGCTGAGG + Intronic
967142244 3:186570831-186570853 GCGAGCCGACGCGGCGGCGGAGG + Exonic
967694420 3:192514899-192514921 GGGAGCCCGGGCGCCGGCAGGGG + Intronic
969720977 4:8892963-8892985 TGGTGCCCACGTCCCCGCGGGGG - Intergenic
972321587 4:37977432-37977454 GCGGGCCCACGGGCCGGCGGCGG + Intronic
973907602 4:55546783-55546805 GGGAGCGCTCGCGGCGGCGGCGG + Intronic
985006013 4:185535671-185535693 CGAAGCCCCCGCGCCCGCCGCGG - Intergenic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
987099940 5:14582294-14582316 GGGAGCCCAGGCAGCGGCGGAGG + Intronic
996900849 5:128539190-128539212 GGGAGCTCACGCGGCCGCGGGGG + Intronic
998281259 5:140809367-140809389 CGGAGCGCACGCGCCCTCGGTGG - Exonic
998288232 5:140884448-140884470 CGGCGCGCACGCGCCCTCGGTGG - Exonic
1002245760 5:177883491-177883513 GAGAGCCCACAAGCCAGCGGAGG - Intergenic
1006136997 6:31901565-31901587 GCGAGCCCGCGCGCCCACGGTGG + Intronic
1012137543 6:95577705-95577727 GAGCGCGCAGGCGCCCGCGGTGG - Intronic
1013155511 6:107489189-107489211 GGGAGCGCACGGTCCCGCGTAGG - Intergenic
1017206292 6:151807671-151807693 GGGAGCCCAGGAGCTGGCGGAGG + Intronic
1018124295 6:160667208-160667230 GGGGGCCAACGCGCACGGGGAGG - Intergenic
1018125604 6:160679388-160679410 GGGCGGCCACGGGCCCGCTGCGG + Intergenic
1019111928 6:169724012-169724034 GGGGGCCCGCGCGGCGGCGGCGG - Exonic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1020020245 7:4862058-4862080 GTGAGCCCTCGCGCTGGCGGCGG - Intronic
1029424953 7:100489299-100489321 GGGAGGCCAGGCAGCCGCGGTGG - Exonic
1035283486 7:157792257-157792279 GAGAGGCCAGGCGCCCGCAGCGG + Intronic
1035580793 8:738097-738119 GGGAGCGCACGGGGCCGCGGAGG + Intronic
1037615160 8:20512532-20512554 GGGAGCCCAGGAGCCCTTGGTGG - Intergenic
1038566264 8:28622538-28622560 GGGAGCCGACGCGGAGGCGGTGG + Intronic
1038568761 8:28641729-28641751 GGGAGGCCACGCGGCGGAGGGGG - Intronic
1049786040 8:144451322-144451344 GGGAACCCACGCCTCCACGGAGG - Intronic
1050388160 9:5111715-5111737 GGTAGCCCACGCGCTCGTGCTGG - Intronic
1051867307 9:21696425-21696447 GGGAGCCCCCAGGCACGCGGGGG - Intergenic
1052048597 9:23821924-23821946 GGCAGGGCACGCGCCGGCGGCGG - Intronic
1053434883 9:38068199-38068221 GGCGGCCCCCGCGCCCGAGGAGG + Exonic
1056153936 9:83817192-83817214 GGGAGCGCGGGCGCCAGCGGCGG + Intronic
1056799570 9:89681538-89681560 GGCAGCCCAGGAGCCCGTGGTGG - Intergenic
1057463776 9:95292432-95292454 GGGCACCCACGGGCCCGAGGCGG - Intronic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1058851212 9:109013497-109013519 GTCAGCCCACCCGCCCGAGGCGG + Exonic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1061261287 9:129482337-129482359 CGGAGACCACCCGGCCGCGGTGG - Intergenic
1062567099 9:137168235-137168257 AGGAGCGCAGGCGCCCGAGGAGG - Exonic
1203791490 EBV:154063-154085 GGGCGCCCAGGCGTCCGGGGAGG + Intergenic
1185736514 X:2500540-2500562 GGGAGGCCACACGCGCGGGGAGG + Intronic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1186545932 X:10449553-10449575 GGATGCCCACGCGCCGGAGGTGG + Exonic
1195909573 X:109875969-109875991 GGCAGCCCAGGAGCCCACGGAGG + Intergenic
1196684075 X:118495912-118495934 GTGAGTCCACCCGCCCGCCGAGG + Exonic