ID: 1019340255

View in Genome Browser
Species Human (GRCh38)
Location 7:505513-505535
Sequence TTGGGGTGGGGTCCCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340255_1019340266 6 Left 1019340255 7:505513-505535 CCCTGCGGGGGACCCCACCCCAA 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1019340266 7:505542-505564 GTTACGGCCTGACCCTTTCAAGG No data
1019340255_1019340260 -10 Left 1019340255 7:505513-505535 CCCTGCGGGGGACCCCACCCCAA 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1019340260 7:505526-505548 CCCACCCCAACTCCAGGTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340255 Original CRISPR TTGGGGTGGGGTCCCCCGCA GGG (reversed) Intronic
900125948 1:1069039-1069061 GAGGGGTGGGGTCGCCCGGAGGG - Intergenic
900473249 1:2864642-2864664 CTGGGGTGGGGGCACCAGCAGGG + Intergenic
900678138 1:3901135-3901157 TTGGGTTGGGGTGGCCCGCCCGG + Intergenic
900713344 1:4128837-4128859 TTTGGGTGGGTTCCCCAGGAGGG - Intergenic
901631764 1:10651493-10651515 CTGGGGTGACGGCCCCCGCACGG + Intronic
902714171 1:18261088-18261110 TTGGCCTGGGGTCCCCAGCTGGG - Intronic
907250983 1:53139351-53139373 TCTGAGTGGGGTCCCCAGCACGG - Intronic
912544404 1:110440589-110440611 TTGGGATGGGGTCTCCCTGAAGG - Intergenic
918205103 1:182301303-182301325 TTGGGGTGGGGTCATACGGAGGG - Intergenic
922769923 1:228176174-228176196 GTGGGGTGGGGGCCAGCGCAGGG + Exonic
923744411 1:236686832-236686854 GTGGGGCCGGGTCCCCCGCGGGG + Intronic
1065203272 10:23334504-23334526 TTGCCATGGGGTGCCCCGCATGG - Intronic
1067337411 10:45376345-45376367 TGGGGGTGGGGGCTACCGCAGGG + Intronic
1067580165 10:47439718-47439740 TTGGGGTGGGCTGCCCCTAAAGG - Intergenic
1070966922 10:80535677-80535699 TGGGGGTGGGTTGCCCAGCATGG - Intergenic
1072470230 10:95706830-95706852 AGGGGGTGGGGTCCCCAGTAAGG - Intergenic
1077048565 11:556607-556629 TTGGGGAGGGGACCCTCGAATGG + Intronic
1081873393 11:46393056-46393078 TTGGTGTGGGGTTCTCCGCGCGG + Intergenic
1083158843 11:60842285-60842307 CTGGCCTGGGGTCCCCCGAAAGG + Exonic
1085530716 11:77190511-77190533 TTGGGGTGGGGTGCACAGCAGGG + Intronic
1089823147 11:121246573-121246595 AAGGGGTTGGGTCCCCCGTAAGG + Intergenic
1095961092 12:47834816-47834838 TTGGGGTGGGGTCCCTATCAGGG + Intergenic
1096709017 12:53441990-53442012 CTGAGGTGGGGTCCTCCCCAGGG + Intronic
1097106591 12:56629787-56629809 TTGGGGTGGAATCCCCGGGAGGG - Intronic
1104970160 12:132527445-132527467 TCGTGGTGGGGTCCTCCCCAGGG - Intronic
1105214903 13:18278333-18278355 ATGGGGTGGGTGCCCCCACAGGG + Intergenic
1106253510 13:28001808-28001830 TCCGGGTGGGGTCCCCAGCAGGG - Intergenic
1106299673 13:28452205-28452227 TTGGGGTGGGAGCCCAGGCAAGG + Intronic
1110423029 13:75335034-75335056 TTGGGGTGGCAGCCCCAGCAGGG - Intronic
1111081907 13:83322059-83322081 GTGGGGTTGGGGCCCCCACACGG - Intergenic
1112586715 13:100724945-100724967 TTGCTGTGGGGTCCCCAACAGGG + Intergenic
1113936823 13:113999305-113999327 TTCAGGTGGCGTCCCCCGCAGGG - Intronic
1114178236 14:20343111-20343133 CTGAGGTGAGGTACCCCGCAGGG - Intergenic
1119920371 14:78440762-78440784 TTGGGGTGGGGTGTGCTGCAGGG + Intronic
1120120969 14:80679971-80679993 TGGGGGTGGGTTCCCCCGATAGG + Intronic
1122246866 14:100409407-100409429 GTGGGGGGGGGTCCTCTGCATGG - Intronic
1122793203 14:104193128-104193150 GTGGGCTGGGGTCTCCCACAAGG - Intergenic
1122984399 14:105205575-105205597 TTGGGGAGGGGTCCCCCAGCAGG - Intergenic
1124631810 15:31342259-31342281 TTGGGGTGGGGTCACTCGGCAGG - Intronic
1124641807 15:31400593-31400615 TGGGGGTGAGGTGCCCTGCAGGG + Intronic
1128258637 15:66216540-66216562 TTGGGGTGGGTTGCTCAGCAGGG - Intronic
1129765398 15:78162375-78162397 ATGGGGTGCCGGCCCCCGCAAGG - Intronic
1132861144 16:2072384-2072406 TTGGGGTGGGGGACCCAGTAGGG + Intronic
1134198949 16:12181707-12181729 TTGAGGGGGGGTCCTCCTCAGGG + Intronic
1136567735 16:31080176-31080198 TGGGGGTGGGGGCACCCGAAAGG + Exonic
1139137416 16:64221747-64221769 TTAGGCTGGGTTCCCCCTCAAGG + Intergenic
1139527939 16:67528229-67528251 TTGGGGTGGGGACGCTGGCAGGG - Intronic
1139802326 16:69533265-69533287 GTGGGGTGATGTTCCCCGCAGGG - Intergenic
1140544255 16:75790988-75791010 GTGGGGTGGGGACTCCTGCAGGG + Intergenic
1141132411 16:81445099-81445121 TGGGGCTGGGGGCGCCCGCAGGG - Intergenic
1142224546 16:88871190-88871212 CTGGGGTGGGGAGCCCCGCCAGG - Intergenic
1146674367 17:34763105-34763127 TTGGGGTAGGGTCCCTGGCCTGG - Intergenic
1148735981 17:49865253-49865275 TTGGGGTGGGGGTCCCCGGAAGG - Intergenic
1148858128 17:50590313-50590335 TTGGGGCAGGGTCCTCCCCATGG + Intronic
1149088670 17:52751426-52751448 AGGGGGTGGGGTCCCCAGTAAGG + Intergenic
1151671776 17:75574927-75574949 TTGGGGCAGGGACCCCCGAAAGG - Exonic
1152403771 17:80084984-80085006 TGGGGGTGAGGTCCCAGGCAGGG + Exonic
1152581026 17:81165713-81165735 GTGGGCTGGCGTCCCCCGCGTGG - Intronic
1154081711 18:11263790-11263812 TGGGGGTGGGTTCCCCCGATAGG - Intergenic
1157752832 18:50194337-50194359 CTGGGGTGGGGTCCACGGCGGGG + Intronic
1161293451 19:3507575-3507597 TTGGGGTGGGGGCCTCACCACGG - Intronic
1161495494 19:4583969-4583991 TGGGGGTGGGGCCTCCCTCAAGG - Intergenic
1162018686 19:7858850-7858872 TTGGGGTGGGGCCCCACTCATGG - Intronic
1162771830 19:12953809-12953831 TTGGGCTGGGGTCCACTGCCTGG - Exonic
1163025334 19:14507729-14507751 TGGGGGTGGGGTCCCTGGCAAGG + Intergenic
1163819391 19:19487438-19487460 GTGGGGTGGGGTGCCGTGCAGGG + Intronic
1164120528 19:22261709-22261731 TTGGGCTGGGGGCCCAGGCAGGG - Intergenic
1164179725 19:22807727-22807749 TCGGGCTGGGGCCCCCTGCAGGG + Intergenic
1164825569 19:31282590-31282612 TTGGGGAGGGGTGCTCCGGACGG - Intronic
1165026981 19:32969439-32969461 AGGGGGTGGGGTCCCCAGTAAGG - Intronic
1165100921 19:33438318-33438340 TTGGTCTGGGGCCCCCTGCAGGG - Intronic
1165166942 19:33863561-33863583 GTGGGTTGGGGTCACCCACAAGG - Intergenic
1165390243 19:35534536-35534558 TAGGGGTGGGGTCCCCCGGTTGG - Intronic
1166015990 19:39979860-39979882 TCTGGGTGAGGGCCCCCGCATGG + Exonic
1168332360 19:55578083-55578105 CTGGGGTGGGGTCCCCGGAGAGG + Exonic
926286966 2:11496254-11496276 TTGGGCTGGGGTCACCAACAGGG + Intergenic
928370726 2:30738339-30738361 GTGGGGTGGGGTTGCCAGCAGGG + Intronic
932570910 2:72937946-72937968 GTGGCCTGGGGGCCCCCGCAAGG - Intergenic
933219300 2:79669957-79669979 TGGGGTTGGGGTCCCCAGTAAGG - Intronic
933278358 2:80305480-80305502 TTGGAGTGGGGTGCACTGCAGGG - Intronic
934299417 2:91768404-91768426 ATGGGGTGGGTGCCCCCACAGGG - Intergenic
938474103 2:131591475-131591497 TGGGCGTGGGGTCGCCCCCAGGG + Intergenic
947627313 2:231628093-231628115 CTGGGGAGGGGTCCCATGCAGGG + Intergenic
947926789 2:233928333-233928355 CTGGGAGGGGGTCACCCGCAGGG - Intronic
948722024 2:239906457-239906479 TTGGCGTGGGGGCCCCCGTCTGG - Intronic
1172573262 20:35986847-35986869 GTGGGGTGGGTTCACCCACAGGG + Intronic
1172693944 20:36808856-36808878 GTGTGGTGGGATCCCCGGCAGGG - Intronic
1172815792 20:37685018-37685040 TTGGAGAGGGGTTCCCAGCAGGG + Intergenic
1173750334 20:45470728-45470750 TAGGGGTGGGGACCCCCCCTTGG - Intronic
1175980205 20:62735000-62735022 TTGGGGTGGGGTGCCGCGTGCGG + Intronic
1178876583 21:36418925-36418947 TTGGGGTGGGGGACCCCTGATGG + Exonic
1179898484 21:44376758-44376780 GTGGGCTGGGGTCCCTTGCAGGG + Intronic
1181286093 22:21753620-21753642 TTGTGGTGGGGTGCCGTGCAGGG + Intergenic
1181601827 22:23957059-23957081 TTGTGGTGGGGTCCATCCCATGG + Intergenic
1181606682 22:23984248-23984270 TTGTGGTGGGGTCCATCCCATGG - Intergenic
1181779895 22:25185022-25185044 TTGGGTTGGGGTGCCCAGCTGGG - Exonic
1182083997 22:27548846-27548868 CTGGGATGGGGTCCCAGGCAAGG + Intergenic
1183211113 22:36451979-36452001 CTGGGGTGGGGCCCCCCCGAGGG - Intergenic
1183601841 22:38844302-38844324 TTGGGGAGGGGGCCCGAGCACGG - Intergenic
1185028938 22:48431692-48431714 GTGGGGTGGGGGCCCCGGCAGGG - Intergenic
1185316985 22:50183562-50183584 TCCGGCTGGGGTCCCCTGCAGGG - Intergenic
949880020 3:8654227-8654249 TGAGGGTGGGGTCCCCAGGATGG - Intronic
950455192 3:13088630-13088652 GTGGGGTGGGGTCCCCGGGAGGG - Intergenic
950833012 3:15893817-15893839 TTGGGGAGGGGTCACCAGCCAGG - Intergenic
961016205 3:123470129-123470151 TTGGGGAAGGGTCCTCCCCAAGG - Intergenic
963270104 3:143278008-143278030 CTGGGGCTGGGTCCCCCGCTTGG + Intronic
968517268 4:1020640-1020662 ATGGGGTGGGGACCCAGGCAGGG + Intronic
968517280 4:1020664-1020686 ATGGGGTGGGGACCCAGGCAGGG + Intronic
968517327 4:1020759-1020781 GTGGGGTGGGGACCCAGGCAGGG + Intronic
968517345 4:1020794-1020816 CTGGGGTGGGGACCCAGGCAGGG + Intronic
968517390 4:1020881-1020903 GTGGGGTGGGGACCCAGGCAGGG + Intronic
968517496 4:1021090-1021112 GTGGGGTGGGGACCCAGGCAGGG + Intronic
968517507 4:1021114-1021136 ATGGGGTGGGGACCCAGGCAGGG + Intronic
968658399 4:1788437-1788459 TGGTGGTGGGGTCCCCCACAGGG - Intergenic
979328398 4:119404104-119404126 GTGGGGTCAGGACCCCCGCAGGG - Intergenic
985490871 5:178112-178134 TTCTGGTGGGGTCCCCCTAAAGG + Intronic
986608876 5:9547260-9547282 GTGAGGTAGGGACCCCCGCAAGG + Intergenic
995833593 5:116378904-116378926 TGGGGGTGGGCTCCCCAGCACGG + Intronic
998128818 5:139640914-139640936 TCGGGTTCGGGTCACCCGCAAGG + Intergenic
1001988205 5:176093979-176094001 GTGGGGTGGGATCCCGTGCAAGG + Intronic
1001989414 5:176103990-176104012 GTGGGGTGGGATCCCGTGCAAGG + Intronic
1002227458 5:177734148-177734170 GTGGGGTGGGATCCCGTGCAAGG - Intronic
1002228663 5:177744161-177744183 GTGGGGTGGGATCCCGTGCAAGG - Intronic
1002266684 5:178039622-178039644 GTGGGGTGGGATCCCGTGCAAGG + Intronic
1002416112 5:179121787-179121809 CTGGGGTGGGGGCCCCAGCCTGG - Intronic
1002421590 5:179152032-179152054 TGGGGGTGGGGGCCCTCTCAGGG - Intronic
1007423497 6:41733630-41733652 TGGGGCTGGGGTCACCGGCATGG + Intronic
1008396975 6:51020165-51020187 TTGTGGTGGGGTCTCCAGTAAGG + Intergenic
1017760188 6:157562508-157562530 TTGGGGTGGGGGCTCCCGAGAGG + Intronic
1017770203 6:157638799-157638821 TTGGGGTGGGGTGTCCTGCAGGG + Intronic
1017919317 6:158857561-158857583 TTGAGGTGGGCTCCCCAGAAGGG - Intergenic
1019340255 7:505513-505535 TTGGGGTGGGGTCCCCCGCAGGG - Intronic
1023401701 7:39796137-39796159 GTGGGGTCAGGACCCCCGCAGGG + Intergenic
1026313862 7:69211339-69211361 GAGGGGTGGGGTCCCTGGCAAGG + Intergenic
1029706795 7:102280485-102280507 GTGGGGTGGGGTCCCCACAATGG - Intronic
1034863969 7:154624763-154624785 CTGGGGTGGGGTCCCTGACATGG - Intronic
1035695229 8:1591054-1591076 ATGGGGTTGGGTCCCGAGCACGG - Intronic
1036997488 8:13675987-13676009 TGGGGGTGGGTTCCCCCGATAGG - Intergenic
1037581294 8:20247346-20247368 TTGGGGGGGGGTCTCCAGCCTGG + Exonic
1038089345 8:24236045-24236067 TCTGGCTGGAGTCCCCCGCAGGG - Intergenic
1041610607 8:59843137-59843159 TTGGGAGAGGGTCCCCAGCATGG + Intergenic
1047324468 8:123823464-123823486 TTGGGGTGAGGACTCCGGCAAGG + Intergenic
1049774576 8:144398473-144398495 TGGGGCTGGGGTCCCCTGCGGGG - Intronic
1056427074 9:86488237-86488259 TTGAGGGTGGGTCCCCCGCAAGG - Intergenic
1057480536 9:95441872-95441894 TTGGAGTGGGGTCCTCAGGATGG + Intergenic
1059523118 9:114962554-114962576 TGGGGGTGGGTTCCCCCGATAGG - Intergenic
1059566298 9:115385828-115385850 AGGGGGTGGGGTCCCCAGTAAGG + Intronic
1061013958 9:127971390-127971412 GTGGGGTGGGCTCCTCTGCATGG - Intronic
1061999120 9:134207284-134207306 ATGGGGTGGGGGCCCCCAGAAGG - Intergenic
1062339864 9:136089221-136089243 TCTGGGTGGGGTCCCCAGCTGGG - Intronic
1185467113 X:361729-361751 TACGTGTGTGGTCCCCCGCAGGG - Intronic
1185966640 X:4613470-4613492 TGGGGGTGGGTTCCCCCGATAGG - Intergenic
1194905966 X:99576563-99576585 TTGGGGTTGGAGCCCCCACACGG + Intergenic
1196788779 X:119445475-119445497 GTGGGGTGGGGTGTCCTGCAAGG + Intronic