ID: 1019340488

View in Genome Browser
Species Human (GRCh38)
Location 7:506751-506773
Sequence GCCGGGGTCCCTAGCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 163}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340488_1019340505 29 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340488_1019340506 30 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data
1019340488_1019340503 16 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340488_1019340493 -7 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340493 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG No data
1019340488_1019340498 1 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340498 7:506775-506797 AGTCACTCCCCCAGGGCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 252
1019340488_1019340495 -6 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340495 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340488 Original CRISPR GCCGGGGTCCCTAGCTGGGT GGG (reversed) Intronic
900189775 1:1348510-1348532 GTGGGGTTCCCTAGCTGGGATGG - Intronic
900193050 1:1359536-1359558 CCCGAGGGCCCCAGCTGGGTGGG + Intronic
903343236 1:22668070-22668092 GCGGGTGTCCCTCCCTGGGTGGG - Intergenic
905867237 1:41382790-41382812 AGAGGGGTCCCTAGCTGGGCTGG - Exonic
906690809 1:47791603-47791625 GCAGGGGCCCCCAGGTGGGTAGG + Intronic
906817632 1:48895358-48895380 TCCTGGGTCCCTTGCTGGGATGG - Intronic
910712513 1:90196320-90196342 GATGGGGTCCCTGGCTGTGTTGG + Intergenic
914783498 1:150807186-150807208 TCCAGGGTCCCTAGCAGGCTTGG + Intronic
915330787 1:155111165-155111187 CCCAGGTTCCCAAGCTGGGTGGG - Intergenic
915359595 1:155277974-155277996 CCCGGGGTCCCTTGGTGGGGCGG + Intronic
916556372 1:165897375-165897397 GCTGTGGTCCTTAGATGGGTGGG + Intronic
919129729 1:193437540-193437562 GACGGGGTGGCTGGCTGGGTGGG + Intergenic
920034846 1:203059222-203059244 GCCTGGGTCCCCAGCTTGGCAGG - Exonic
920385650 1:205568929-205568951 GGCGGGGCCCCTCGCTGGGGCGG + Intronic
920693130 1:208161947-208161969 GCCTGGGTGCCTGGCAGGGTAGG + Intronic
920873806 1:209816157-209816179 GCCGGTTTCCCGGGCTGGGTGGG - Intergenic
921995749 1:221416184-221416206 GCCAGGGTTCCTTGCTGAGTGGG - Intergenic
922272905 1:224050920-224050942 TCCCGGGTCCCAAGGTGGGTGGG - Intergenic
922470823 1:225876168-225876190 GGCAGGGACCCTAGCTGGGCTGG - Intronic
924787342 1:247210657-247210679 GGCGGGGTCCCGAGGTGGGCAGG - Intergenic
1063505334 10:6593032-6593054 GCCGGGGTACCTAGCAGGAGGGG + Intergenic
1067153360 10:43753979-43754001 GCCAGGCTCCCCAGGTGGGTGGG + Intergenic
1073118661 10:101108122-101108144 GCCTGGGTCCCTGGCAGGGCTGG - Intronic
1073539979 10:104310253-104310275 GCCGGCTTCCCGAGCAGGGTTGG - Exonic
1077324123 11:1956391-1956413 GGCGGCGTCCCCAGCTGGTTCGG + Exonic
1079308588 11:19345445-19345467 TCCGGGGTCCAGAGCAGGGTGGG + Intergenic
1081540824 11:44033471-44033493 GCCTGGTTCCCTGGCTGGGAAGG - Intergenic
1083572182 11:63766738-63766760 GGCGGGGGCCCCAGGTGGGTGGG - Intronic
1083936164 11:65871232-65871254 GCGGGGGTCCCTCGCCGTGTAGG + Exonic
1085298315 11:75443371-75443393 GCCGGGATCCTGTGCTGGGTGGG - Intronic
1089079146 11:115761533-115761555 GGCAGGCTCCGTAGCTGGGTGGG - Intergenic
1089203524 11:116740008-116740030 GCCAGTGTCTCTTGCTGGGTGGG - Intergenic
1202807109 11_KI270721v1_random:11586-11608 GGCGGCGTCCCCAGCTGGTTCGG + Intergenic
1096801387 12:54112760-54112782 GCCCTGGTCCCTGGCTGGGGTGG - Intergenic
1098024734 12:66189510-66189532 GCTGGGGTCCCTCGCGGGGCTGG + Intronic
1099695596 12:86014851-86014873 GACGGGATCTCTTGCTGGGTTGG + Intronic
1100600174 12:96106173-96106195 GCCGAGGGCCCTGGCTTGGTGGG + Intergenic
1102012710 12:109628500-109628522 TCAGGGGACCCTAGCTAGGTGGG + Intergenic
1102950621 12:117028408-117028430 GCCAGGGTGGCCAGCTGGGTGGG - Exonic
1103524164 12:121556562-121556584 GCCATGGTGCCCAGCTGGGTTGG - Intronic
1104410307 12:128552071-128552093 GGCGGGCTCCCCAGCGGGGTCGG + Intronic
1118372034 14:65145377-65145399 GCTGGTGTCACTAGCAGGGTTGG - Intergenic
1121713955 14:96059636-96059658 TGGGGGGGCCCTAGCTGGGTTGG + Intronic
1122159520 14:99773384-99773406 TCCAGGGGCCCTAGCTGTGTGGG - Intronic
1122304229 14:100751547-100751569 GCCGGGGTCCATAGCAGAGCGGG - Intergenic
1122348591 14:101075139-101075161 GCCAGGGACCCTGGATGGGTAGG + Intergenic
1123019159 14:105389561-105389583 GCAGGGGTGCCCAGCTTGGTGGG + Intronic
1123051890 14:105547991-105548013 GCCGGGGTCCCCAGCAGTGCTGG + Intergenic
1123065523 14:105617072-105617094 GCAGGGGCACCTAGCAGGGTGGG + Intergenic
1125301009 15:38253008-38253030 GCCGGGGTTCCCGGCTGGGGGGG + Exonic
1125756866 15:42070552-42070574 GCCAGGGTCCTTAGGTGGGAAGG - Intronic
1126436832 15:48645543-48645565 GCCGGGGTCCCGACGGGGGTCGG - Intronic
1129468662 15:75738378-75738400 CCCGGGGTCCCCAGGTGAGTAGG - Intergenic
1130275269 15:82472932-82472954 GCCGGGGTCCCCAGGTAAGTAGG + Intergenic
1130467629 15:84200327-84200349 GCCGGGGTCCCCAGGTAAGTAGG + Intergenic
1130496636 15:84473215-84473237 GCCGGGGTCCCCAGGTAAGTAGG - Intergenic
1130589921 15:85204925-85204947 GCCGGGGTCCCCAGGTAAGTAGG + Intergenic
1130946439 15:88553004-88553026 GACGGGGTGGCTGGCTGGGTGGG + Intergenic
1131149068 15:90035613-90035635 GCCGGGCTCTCTAGCTGGGGCGG + Intronic
1132496596 16:266329-266351 GCCAGGGTGCCCAGCTTGGTGGG - Intronic
1132915470 16:2341356-2341378 TCGGGGGTCCCCAGCCGGGTAGG + Intergenic
1133100538 16:3476484-3476506 GCAGGGGTCCCTAGATGAGGTGG - Intronic
1133206507 16:4237351-4237373 GCCTGGCTCCCAAGCTGGGAAGG + Intronic
1133885642 16:9825112-9825134 GCAGGGTTCCCTTGCTGTGTAGG + Intronic
1135206808 16:20491817-20491839 GCCAGGGTCCGGAGCTGTGTAGG - Intergenic
1135212077 16:20531815-20531837 GCCAGGGTCCGGAGCTGTGTAGG + Intergenic
1138487127 16:57352895-57352917 GCCGAGGTCCCTCCATGGGTGGG - Intergenic
1138585055 16:57964058-57964080 CCAGGGCTCCCTAGCTGGGAGGG + Intronic
1142175617 16:88643641-88643663 CCCAGGGCCCCTAGCGGGGTGGG - Intronic
1142825446 17:2507341-2507363 GACGGGGTGGCTGGCTGGGTGGG - Intronic
1142998256 17:3774135-3774157 GCCAGGGTTCCTGGCTGGGCAGG - Intronic
1143654452 17:8285734-8285756 CCAGGGGTCCCCAGCTGCGTAGG + Intergenic
1146223876 17:31049562-31049584 GCTGGGGTCTCCTGCTGGGTTGG + Intergenic
1147327098 17:39674844-39674866 CCCAGGGACCCTGGCTGGGTGGG - Intronic
1148081061 17:44967926-44967948 GCCGGGGCCCCGCGCGGGGTAGG + Exonic
1148441574 17:47714275-47714297 GCCGGGCATCCTAGCTGGGAAGG + Intergenic
1149550133 17:57533745-57533767 TCAGGGGTCCCCAGCTGGGGTGG + Intronic
1151669634 17:75564994-75565016 GGCTGGGTCTCTAGCTGGGGAGG - Intronic
1152523038 17:80871490-80871512 GCCTGGGTCCCTGGCTGAGGTGG + Intronic
1156514112 18:37665535-37665557 GCCGGGCTCCCCACCTGGGCTGG - Intergenic
1160094511 18:75859651-75859673 GCAGGGGGCCCCAGCTGGGAGGG - Intergenic
1160318669 18:77870278-77870300 GCCGGGATCCCTGGCTGCATTGG - Intergenic
1160767454 19:814774-814796 GCTGGGGTCCCCAGGTGGGCGGG - Intronic
1160865105 19:1252877-1252899 GCCGGGGTCCCGAGCCAGGGCGG + Intronic
1161001549 19:1913481-1913503 GCCAGGGTCCCGAGTGGGGTGGG + Intronic
1161265168 19:3360361-3360383 CGCGGGGTCCCCAGCTGGGAGGG + Intronic
1161669911 19:5601041-5601063 GCCGGGAACCCTGCCTGGGTCGG - Intronic
1161954038 19:7483076-7483098 GGCGGGGTCCCAAGGGGGGTGGG - Intronic
1163361215 19:16847431-16847453 GCTGGGGTCCCAGGCAGGGTGGG - Intronic
1164674680 19:30093301-30093323 GCCGGGGTCTCCAGCTGCCTTGG - Intergenic
1164747432 19:30626793-30626815 GCCGGGATCCCTATCTGGCGCGG - Intronic
1165956100 19:39503082-39503104 GCCGGGGTCCCCGGCTGGGACGG - Intronic
1167166693 19:47803719-47803741 GACGGGGTCCCTAGGGGGGCTGG - Intronic
1167175144 19:47860045-47860067 GACGGGGTCCCTAGGGGGGCTGG + Intergenic
1167722035 19:51185737-51185759 GCCTGGGTCCCTGGTGGGGTGGG + Intergenic
1168100496 19:54138525-54138547 GACGAGGACCCCAGCTGGGTGGG + Intronic
932404455 2:71504075-71504097 GCCGGGGCTCCTGGCTGGCTGGG + Intronic
933436706 2:82258389-82258411 GCCTGGTTCCCTGGCTGGGCTGG - Intergenic
934575945 2:95401712-95401734 TCCTGGGTCTCTAGCTCGGTAGG - Intergenic
936504717 2:113096464-113096486 GACGGGGTGGCTGGCTGGGTGGG + Intergenic
937638047 2:124179082-124179104 GCCAGGGTCACGGGCTGGGTGGG - Intronic
945110409 2:206356427-206356449 GACGGGGTGGCTGGCTGGGTGGG + Intergenic
945110582 2:206356826-206356848 GACGGGGTGGCTGGCTGGGTGGG + Intergenic
947800886 2:232928044-232928066 GCCGGGGCCCTGGGCTGGGTCGG + Intronic
948461279 2:238131072-238131094 GCCGGGGGCCCTCGCTGGGCGGG - Exonic
1171853149 20:30322559-30322581 GCCCTGGTCCCTGGCTGGGGTGG - Intergenic
1172432790 20:34906416-34906438 GCTGGGGCCCCTGGCTGGTTGGG - Intronic
1172629908 20:36371126-36371148 GCTGGGGTCCCTGGCAGGGCAGG + Intronic
1175465917 20:59191323-59191345 GCCGGCTTCCCCACCTGGGTGGG - Exonic
1180103117 21:45599164-45599186 GCCGGGCTCCCTGGCTAGGATGG + Intergenic
1180220598 21:46355804-46355826 GGCGGGGTCACTGGCTGGGCAGG + Intronic
1180799309 22:18624399-18624421 GCAGGGGTCCCTAGAGAGGTGGG - Intergenic
1180996628 22:19969127-19969149 GGCGGGGCCCCTAGCTGGCTGGG + Exonic
1181222409 22:21370867-21370889 GCAGGGGTCCCTAGAGAGGTGGG + Intergenic
1181638169 22:24183853-24183875 GCAGGGGTCCCTAGAGAGGTGGG + Intronic
1182904108 22:33921258-33921280 GCCGGGATCCCGGGCCGGGTCGG + Intronic
1183481755 22:38069134-38069156 CCCCGGGGCCCCAGCTGGGTGGG - Intronic
1184392745 22:44214355-44214377 GCTGGGGTGGCCAGCTGGGTGGG - Intronic
1184457662 22:44620796-44620818 GCCTGGGTCCCCAGATGGCTTGG + Intergenic
949564413 3:5231823-5231845 GCCGGGGTTGCAATCTGGGTTGG - Intergenic
954314203 3:49792411-49792433 ACTGGGGTCCATAGGTGGGTTGG + Intronic
962840694 3:139230041-139230063 CCCTGGGTCCCTAAATGGGTCGG + Intronic
962840713 3:139230114-139230136 CCCTGGGTCCCTAAATGGGTCGG + Intronic
967311116 3:188107215-188107237 GCCGTGGTCCAAAGCTGGCTTGG - Intergenic
967844208 3:194031511-194031533 GCCTGGCTTCCCAGCTGGGTTGG + Intergenic
969271537 4:6106429-6106451 AGTGGGGTCCCTAGCTGGGCTGG + Intronic
969410384 4:7024362-7024384 GTGGGGATCCCCAGCTGGGTGGG - Intronic
984594652 4:181653868-181653890 ACCGGGGTCTGTTGCTGGGTCGG - Intergenic
985456319 4:190082055-190082077 GCCGGGGTCCCCAGGTCGCTGGG + Exonic
992663570 5:78984803-78984825 GCCGGGACCCATAACTGGGTCGG + Intronic
1002060173 5:176621143-176621165 GCTGCCGTCCCTAGCTGGGGTGG - Intronic
1002284199 5:178151468-178151490 GCCAGGGTTCCTAGCTGGCCAGG + Intronic
1003418863 6:5938158-5938180 CCCGGGGTCCCCTGCTGGGGTGG - Intergenic
1005023162 6:21436848-21436870 GCTGTGGTCCCTTACTGGGTTGG - Intergenic
1008564257 6:52751744-52751766 GCAGGGGTCCCAGCCTGGGTGGG - Intronic
1013458981 6:110357884-110357906 GCCGGGCTCCGTAGCGCGGTCGG + Intronic
1015096321 6:129417952-129417974 GCCTGGGTCCACAGCTGGCTGGG + Intronic
1018613168 6:165662566-165662588 GCCGGGGCCCCCAGCGGGGCTGG + Intronic
1019260902 7:81547-81569 AGCCGGATCCCTAGCTGGGTCGG + Intergenic
1019340488 7:506751-506773 GCCGGGGTCCCTAGCTGGGTGGG - Intronic
1021576777 7:22112376-22112398 GCCAGGCTCCCTAACTGGGTGGG - Intergenic
1023079543 7:36514336-36514358 GGCTGGGTCCCTGACTGGGTGGG + Intronic
1023763004 7:43484131-43484153 GCTGGGGTCCCTGGCAGGGGAGG - Intronic
1029438246 7:100574207-100574229 CCCGGGGTCCCGGGCGGGGTGGG + Intronic
1029501577 7:100933939-100933961 GCAGGGCTCCCTGGATGGGTGGG - Intergenic
1032011452 7:128350708-128350730 CCAGGGGTCCCTGGGTGGGTGGG - Exonic
1034560813 7:151878018-151878040 GCCGAGGGCCCTAGAGGGGTTGG + Intergenic
1038429253 8:27486534-27486556 GCCAGGGTCCCTGGCTGGCAGGG - Intergenic
1046198508 8:110892682-110892704 GCCGAGGTGCCTGGCTCGGTGGG - Intergenic
1049406072 8:142452363-142452385 GCCGGGGTCCCGCGCAGGGGCGG + Intronic
1051477963 9:17529593-17529615 GCCGGGGCCTATAGCGGGGTAGG - Intergenic
1053034076 9:34809889-34809911 GCCGGTGCCCCTAGCTGATTCGG + Intergenic
1053790944 9:41685858-41685880 GCCCTGGTCCCTGGCTGGGGTGG - Intergenic
1054154206 9:61628914-61628936 GCCCTGGTCCCTGGCTGGGGTGG + Intergenic
1054179291 9:61897552-61897574 GCCCTGGTCCCTGGCTGGGGTGG - Intergenic
1054473993 9:65560034-65560056 GCCCTGGTCCCTGGCTGGGGTGG + Intergenic
1054658247 9:67683269-67683291 GCCCTGGTCCCTGGCTGGGGTGG + Intergenic
1059061430 9:111038328-111038350 GCCGGGGTCCCGTGCTCGGCCGG + Intronic
1060827476 9:126695252-126695274 CCTGGGGTGCCGAGCTGGGTGGG - Intronic
1061061135 9:128250927-128250949 CCCGGGGTCCCCAGGTGAGTAGG + Exonic
1062334329 9:136058357-136058379 TCCCGGGTCCCTGGCTGGGAAGG - Intronic
1062339862 9:136089217-136089239 GGTGGGGTCCCCAGCTGGGAGGG - Intronic
1062426424 9:136508196-136508218 GGCTGGGACCCGAGCTGGGTGGG + Intronic
1198370739 X:135986102-135986124 CCCCGGGTCCCGAGCTTGGTAGG - Intronic
1200210796 X:154345833-154345855 GCCAGGGTCCCCAACTGTGTGGG - Intergenic
1200220056 X:154386259-154386281 GCCAGGGTCCCCAACTGTGTGGG + Intergenic
1200924931 Y:8645900-8645922 GCCAGTGTCTCTTGCTGGGTTGG - Intergenic
1202125565 Y:21566281-21566303 GCTGGTGTCCCTCCCTGGGTTGG - Intergenic
1202153443 Y:21863111-21863133 GCTGGTGTCCCTCCCTGGGTTGG + Intergenic