ID: 1019340489

View in Genome Browser
Species Human (GRCh38)
Location 7:506752-506774
Sequence GGCCGGGGTCCCTAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340489_1019340503 15 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340489_1019340505 28 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340489_1019340498 0 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340498 7:506775-506797 AGTCACTCCCCCAGGGCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 252
1019340489_1019340506 29 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data
1019340489_1019340493 -8 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340493 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG No data
1019340489_1019340495 -7 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340495 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340489 Original CRISPR GGCCGGGGTCCCTAGCTGGG TGG (reversed) Intronic
900114880 1:1024178-1024200 GGCTGGGGTCCCTGGCTGCCGGG + Intronic
900173230 1:1280826-1280848 GGCCGGTGTCCCCTGCTGGGAGG - Intronic
900427164 1:2586159-2586181 GGCCGGGGTCTCCCGCGGGGCGG - Intergenic
900651045 1:3730222-3730244 GCCCTGGGTCCCGAGCTGGGTGG - Intronic
900715486 1:4141102-4141124 GGCCGGGGCCCATGGCAGGGAGG - Intergenic
901218813 1:7570599-7570621 GGCAGGGGTGCCTTGCTGGTTGG + Intronic
904068434 1:27773429-27773451 AGCCGGGGTACCGAGCTGGGGGG + Intronic
905783197 1:40730922-40730944 GGCCGGGGTCACTCTCTGTGTGG + Intronic
905848791 1:41257747-41257769 GGCTGGGGACCCCAGTTGGGAGG + Intergenic
906705922 1:47895256-47895278 GGCTGGGCTTCCTGGCTGGGGGG - Intronic
911090111 1:94011208-94011230 GCCCTGGGTCCAAAGCTGGGAGG - Intronic
913410129 1:118542243-118542265 GGCTGGAGACCCCAGCTGGGAGG - Intergenic
915940452 1:160115503-160115525 GGCCTGGGTCCCAGGTTGGGGGG - Intergenic
916556371 1:165897374-165897396 GGCTGTGGTCCTTAGATGGGTGG + Intronic
917352195 1:174089940-174089962 GGCTGGAGTCCCTGGTTGGGAGG + Intergenic
918413979 1:184288282-184288304 GGCCGAGGTGCCTGGCTTGGGGG + Intergenic
919129728 1:193437539-193437561 GGACGGGGTGGCTGGCTGGGTGG + Intergenic
919779900 1:201215080-201215102 TGCAGGGGACCCAAGCTGGGAGG + Exonic
919854189 1:201694458-201694480 GGCCGGGGTCACCAGCTGCTGGG + Intronic
920660352 1:207909854-207909876 GGCAGCTGTCCCCAGCTGGGCGG + Intronic
921995750 1:221416185-221416207 GGCCAGGGTTCCTTGCTGAGTGG - Intergenic
922272906 1:224050921-224050943 GTCCCGGGTCCCAAGGTGGGTGG - Intergenic
923564990 1:235069928-235069950 GGCCGGGGTCCCTAGGGGACAGG - Intergenic
1063505333 10:6593031-6593053 GGCCGGGGTACCTAGCAGGAGGG + Intergenic
1064982017 10:21174359-21174381 GGCCGGGGAGCCCAGGTGGGCGG + Intergenic
1067026528 10:42847600-42847622 GGACGGGGTGGCTGGCTGGGCGG - Intergenic
1068668091 10:59697124-59697146 GGACGGGGTGGCTGGCTGGGCGG - Intronic
1068811146 10:61257217-61257239 GGCCAGAGGCCCTAGCTGGGAGG + Intergenic
1075500108 10:122965315-122965337 GGCTGGAGACCCCAGCTGGGAGG - Intronic
1076947923 10:133664777-133664799 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076948913 10:133668087-133668109 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
1076949897 10:133671386-133671408 GGCCGGGGTCCCCAGGTCGCCGG + Intronic
1076950881 10:133674685-133674707 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076951871 10:133677995-133678017 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076952860 10:133681305-133681327 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076953844 10:133684604-133684626 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076954828 10:133740956-133740978 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076955817 10:133744266-133744288 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076956807 10:133747576-133747598 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076957794 10:133750885-133750907 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076958779 10:133754184-133754206 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076959768 10:133757494-133757516 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1076960752 10:133760793-133760815 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
1077297276 11:1832112-1832134 GGCTGGGGGCCCTAACGGGGTGG + Intronic
1077488567 11:2850192-2850214 GGCCAGGGTCCCGGGGTGGGCGG - Intergenic
1077843030 11:5995077-5995099 GGCCGGGTGCCATAGCTGGGCGG + Intergenic
1078929269 11:15901055-15901077 AGCCTGGCTCCATAGCTGGGGGG - Intergenic
1078934317 11:15938536-15938558 GCCAGGGGTGCCCAGCTGGGAGG - Intergenic
1080513766 11:33001143-33001165 GGCTGGAGGCCCTCGCTGGGAGG + Intergenic
1081288730 11:41304060-41304082 GGACGGGGTGGCTGGCTGGGCGG - Intronic
1082004040 11:47409988-47410010 TGCCAGGGTCCCTTGCGGGGAGG + Intronic
1082938629 11:58680382-58680404 GGCTGGAGTCCCTGGTTGGGAGG - Intronic
1084179350 11:67438725-67438747 GGCGGGGGCCCCTAGGTGGGAGG + Exonic
1084196141 11:67524322-67524344 GGCTGGGGTCCCCCGTTGGGAGG + Intergenic
1087328995 11:96755806-96755828 GGCCGGAGACCCCAGCTGGGAGG + Intergenic
1087606545 11:100384439-100384461 GGCCAGAGGCCCTGGCTGGGAGG - Intergenic
1088729810 11:112670908-112670930 GGCTGGAGACCCTGGCTGGGAGG - Intergenic
1089079147 11:115761534-115761556 GGGCAGGCTCCGTAGCTGGGTGG - Intergenic
1091243336 11:134069473-134069495 GGGCGGGGTCCTGTGCTGGGCGG + Intronic
1091372695 11:135073992-135074014 GGCTGGGGGCCCAGGCTGGGAGG - Intergenic
1093086174 12:14868878-14868900 GGCCTGGGGCCCCAGCTGGGAGG + Intronic
1093599385 12:21002899-21002921 AGCTGGGCTCCCTAGCTGTGTGG - Intergenic
1095961093 12:47834819-47834841 GGGTGGGGTCCCTATCAGGGAGG + Intergenic
1096256542 12:50065318-50065340 AGAAGGGGTGCCTAGCTGGGTGG + Intronic
1096351123 12:50902250-50902272 GGCTGGGTTCCCCACCTGGGTGG - Intergenic
1097247221 12:57613215-57613237 GGTCGGGGACAGTAGCTGGGTGG - Intronic
1097601077 12:61694333-61694355 GGCCATGCTCCCCAGCTGGGAGG - Intergenic
1098674012 12:73266361-73266383 GGCTGGAGTCCCTGGCTCGGAGG - Intergenic
1099369488 12:81812096-81812118 GGCCAGAGTCCCTGGCTGGGAGG - Intergenic
1099667862 12:85654163-85654185 GGCTGGAGACCCTGGCTGGGAGG + Intergenic
1101935439 12:109052905-109052927 GGCCTGGGCCCGTAGGTGGGAGG + Intronic
1102012709 12:109628499-109628521 GTCAGGGGACCCTAGCTAGGTGG + Intergenic
1102950622 12:117028409-117028431 GGCCAGGGTGGCCAGCTGGGTGG - Exonic
1103446944 12:121000875-121000897 GGCCGTGGACCCTGGCTGGGAGG + Intronic
1103779634 12:123389792-123389814 GGCCGCGGTCCCAGGCTGTGCGG + Intronic
1103831975 12:123787607-123787629 GGCGGGAGTCCCAAGCTGCGAGG - Intronic
1104411436 12:128561446-128561468 GTCAGAGGTCCCTAACTGGGAGG - Intronic
1108608595 13:52063963-52063985 GGACGGGGTGGCTGGCTGGGCGG - Intronic
1113521452 13:110944763-110944785 GACGGGGCTCCCTAGATGGGTGG + Intergenic
1115680385 14:35731092-35731114 AGCCGGGGAGACTAGCTGGGTGG + Intronic
1116493721 14:45536336-45536358 GGCTGGGGGCCTTAGCTGGGAGG + Intergenic
1117829261 14:59733695-59733717 GGCCAGAGGCCCCAGCTGGGAGG - Intronic
1119866825 14:77981184-77981206 GGCCGAGAGCCCTAGCTGCGGGG + Intergenic
1121429878 14:93879190-93879212 TGGGGGGGTCCCTAGCAGGGCGG - Intergenic
1121617848 14:95325058-95325080 GCCCGGTGTCCCTACCTGGAAGG + Intergenic
1122304230 14:100751548-100751570 AGCCGGGGTCCATAGCAGAGCGG - Intergenic
1122825559 14:104368882-104368904 TGCCAGGGGCCCTAACTGGGAGG - Intergenic
1122855922 14:104560017-104560039 AGCCGGGGTCCTGGGCTGGGTGG - Intronic
1123065522 14:105617071-105617093 GGCAGGGGCACCTAGCAGGGTGG + Intergenic
1202853736 14_GL000225v1_random:37296-37318 GGCCGGGGTCACTAGGTCGCCGG + Intergenic
1202860581 14_GL000225v1_random:79102-79124 GGCCGGGGTCCCCAGGTCGCAGG - Intergenic
1125274983 15:37979836-37979858 GGCTGGGGTCCCAGGTTGGGAGG + Intergenic
1125301008 15:38253007-38253029 GGCCGGGGTTCCCGGCTGGGGGG + Exonic
1126225288 15:46262481-46262503 GGCTGGAGACCCTAGTTGGGAGG + Intergenic
1126786011 15:52178519-52178541 AGCCTGGGTCCCTTGGTGGGGGG + Intronic
1126851359 15:52798913-52798935 GGCCCAGGACCCTAGCTAGGGGG - Intergenic
1128582574 15:68819668-68819690 GGCCGGGGGTTCGAGCTGGGGGG + Intronic
1129110711 15:73335579-73335601 GGCCAGGGTCCTCTGCTGGGGGG - Intronic
1129254241 15:74325109-74325131 AGCCAGGGACCCTTGCTGGGTGG - Intronic
1129328050 15:74812471-74812493 GGCCTGTCTCCCTAACTGGGAGG + Intergenic
1129440835 15:75579545-75579567 GGGAGGGGACCCTAGCTGGACGG + Intergenic
1130048511 15:80464444-80464466 GGCCTGGGTCCCTGCTTGGGAGG + Intronic
1130853142 15:87817686-87817708 GGCAGTGGTTCCTAACTGGGGGG + Intergenic
1130946438 15:88553003-88553025 GGACGGGGTGGCTGGCTGGGTGG + Intergenic
1132496597 16:266330-266352 GGCCAGGGTGCCCAGCTTGGTGG - Intronic
1132730044 16:1356661-1356683 GGCCTGGCTCCCCAGCTGGGAGG - Intronic
1134132548 16:11659367-11659389 GGCAGGGGCCCCGAGCAGGGCGG + Intergenic
1136540885 16:30927230-30927252 GGCCAGGGTCCCTAGAAGGAAGG + Intronic
1137366076 16:47860833-47860855 GGCCGGGGCCCCTATCTTTGTGG + Intergenic
1137401470 16:48157054-48157076 GGCCGGGGAGCCTTCCTGGGAGG - Intergenic
1138487128 16:57352896-57352918 GGCCGAGGTCCCTCCATGGGTGG - Intergenic
1138585053 16:57964057-57964079 CCCAGGGCTCCCTAGCTGGGAGG + Intronic
1141172411 16:81699812-81699834 GGTCGGGGTCCCTGGTGGGGTGG + Intronic
1141335722 16:83153306-83153328 GGCCAGTGTCTCTATCTGGGTGG + Intronic
1141820845 16:86444447-86444469 GGCCGGGGGCCCTGGCTGGCTGG + Intergenic
1142325835 16:89413937-89413959 TGCTGGGGTCCCTGTCTGGGTGG - Intronic
1142585074 17:967136-967158 GGCTGGGGTCCCAAGCCAGGTGG - Intronic
1142825447 17:2507342-2507364 GGACGGGGTGGCTGGCTGGGTGG - Intronic
1142939655 17:3371444-3371466 GGACGGGGTGGCTGGCTGGGCGG + Intergenic
1143078631 17:4365935-4365957 GGCCGGGGCCGCCAGCTTGGAGG - Intronic
1143788110 17:9271940-9271962 GCCAGGGCTCCCTAGCTGGAAGG + Intronic
1144519730 17:15945650-15945672 GGCCGGGGTTCCTCCCTCGGGGG + Intronic
1146077463 17:29744313-29744335 GGCTGGGGTCCCTCTCTGGCAGG + Intronic
1147648868 17:42050677-42050699 GGCCAGGGTCCCGGGCAGGGCGG + Intronic
1147995772 17:44359717-44359739 GGAGGGGGTGCCTGGCTGGGGGG - Intronic
1149416497 17:56465354-56465376 GGCCGCAGTCCCTACCTGTGAGG + Intronic
1150196480 17:63304724-63304746 GGCCTGAGTCCCTAGGTGGAAGG - Intronic
1152478337 17:80533125-80533147 GGGCTGGGTCCAAAGCTGGGAGG - Intergenic
1152649335 17:81484645-81484667 GGCCGGTGTTCCCAGCTGGAAGG + Intergenic
1154278103 18:12979671-12979693 GGACGGGGTGGCTGGCTGGGCGG + Intronic
1154437284 18:14356897-14356919 GTCCAGGGTCCCTGGGTGGGGGG + Intergenic
1157490929 18:48123306-48123328 AGCTGGGGTCCCCATCTGGGTGG - Intronic
1160094512 18:75859652-75859674 GGCAGGGGGCCCCAGCTGGGAGG - Intergenic
1160767455 19:814775-814797 AGCTGGGGTCCCCAGGTGGGCGG - Intronic
1160864006 19:1249333-1249355 GGCCGGGGTCCCGGGGCGGGCGG - Intronic
1161001548 19:1913480-1913502 GGCCAGGGTCCCGAGTGGGGTGG + Intronic
1161265167 19:3360360-3360382 GCGCGGGGTCCCCAGCTGGGAGG + Intronic
1161722141 19:5909019-5909041 GGCCGGGGTCACTGGCCGGCAGG - Exonic
1161954039 19:7483077-7483099 GGGCGGGGTCCCAAGGGGGGTGG - Intronic
1162604251 19:11694704-11694726 GCCCGGAGTCGCTGGCTGGGAGG + Intergenic
1162751861 19:12834162-12834184 GGGCGGGGTCCCCAGCGCGGCGG - Intronic
1162953161 19:14083752-14083774 TGCAGGGGTCCATAGATGGGGGG + Exonic
1163361216 19:16847432-16847454 GGCTGGGGTCCCAGGCAGGGTGG - Intronic
1163390374 19:17026917-17026939 GGTCGGGGTCCGGAGATGGGCGG - Intergenic
1163582226 19:18145682-18145704 GGCTGGGGTCCCCAGATGTGGGG + Intronic
1164168460 19:22702885-22702907 GGACGGGGTGGCTGGCTGGGCGG + Intergenic
1165408447 19:35644135-35644157 GTCCTGGGTCCCGAGTTGGGAGG + Intronic
1166678701 19:44754654-44754676 GGCCTGGGTCCCTCTCGGGGCGG - Intronic
1166751724 19:45167042-45167064 GGCTGGGGACGCAAGCTGGGAGG - Intronic
1168056416 19:53867475-53867497 GGGCGGGGACCTGAGCTGGGGGG + Intronic
1168100495 19:54138524-54138546 GGACGAGGACCCCAGCTGGGTGG + Intronic
1168317412 19:55490228-55490250 GGCCTGGGCCCCCAGGTGGGAGG + Intronic
927887674 2:26728603-26728625 GGCGGGGGACCCCTGCTGGGAGG + Exonic
932404454 2:71504074-71504096 GGCCGGGGCTCCTGGCTGGCTGG + Intronic
934263825 2:91499148-91499170 GGCCGGCTTGCCTGGCTGGGTGG + Intergenic
934809110 2:97266100-97266122 GGCTGGAGGCCCTAGTTGGGAGG + Intergenic
934828395 2:97491069-97491091 GGCTGGAGGCCCTAGTTGGGAGG - Intergenic
935834608 2:107037004-107037026 GGCCGGAGACCCCAGTTGGGAGG - Intergenic
935845708 2:107163505-107163527 GGTGGGGGTGCCTAGCTGGGAGG + Intergenic
936504716 2:113096463-113096485 GGACGGGGTGGCTGGCTGGGTGG + Intergenic
936861996 2:117029883-117029905 GGCTGGAGGCCCTGGCTGGGAGG - Intergenic
938337664 2:130513652-130513674 GGCTGGGGTCCCAGCCTGGGTGG - Intergenic
938352175 2:130607083-130607105 GGCTGGGGTCCCAGCCTGGGTGG + Intergenic
938952539 2:136268546-136268568 TCCAGGGGTCCTTAGCTGGGTGG - Intergenic
940124610 2:150309941-150309963 GGCTGGAATCCCTGGCTGGGAGG - Intergenic
941052072 2:160746432-160746454 GGTCTGGGTCCCAAACTGGGAGG - Intergenic
942946580 2:181680572-181680594 GGGCGGGGCCGCTAGCTGAGGGG + Exonic
943578087 2:189653780-189653802 GGACGGGGTGGCTGGCTGGGCGG - Intergenic
945110408 2:206356426-206356448 GGACGGGGTGGCTGGCTGGGTGG + Intergenic
945110581 2:206356825-206356847 GGACGGGGTGGCTGGCTGGGTGG + Intergenic
946786056 2:223245931-223245953 GGCTGGAGGCCCTGGCTGGGAGG + Intergenic
947731135 2:232432372-232432394 GCCCGGGGTCCTTAGCAGGCTGG - Intergenic
947747449 2:232516180-232516202 GGGCCGTGTCCCTAGATGGGAGG - Intergenic
947768319 2:232651530-232651552 GGCCCTGGACCCTACCTGGGAGG + Intronic
948177953 2:235959040-235959062 GACTGGGGTCCCGAGCTGCGCGG - Intronic
948461280 2:238131073-238131095 AGCCGGGGGCCCTCGCTGGGCGG - Exonic
948645358 2:239400823-239400845 CGCCGGGGGCCCAGGCTGGGAGG + Exonic
948653650 2:239464060-239464082 GGCCGGGGCCCCTGGAGGGGTGG + Intergenic
948825636 2:240572370-240572392 GGCCCAGCACCCTAGCTGGGTGG + Intronic
948892285 2:240913301-240913323 GCCCGGGCTCTCTAGCTGGTGGG + Intergenic
1169065436 20:2692485-2692507 GGCCGGGCTCCCTCGCCGCGCGG + Intergenic
1170000575 20:11609071-11609093 GCCCTGGGTCCCTGGTTGGGCGG + Intergenic
1170508569 20:17054269-17054291 GGCTAGGGACCCTAGTTGGGAGG + Intergenic
1172432791 20:34906417-34906439 GGCTGGGGCCCCTGGCTGGTTGG - Intronic
1172786789 20:37473802-37473824 GGCCGGTGTCTCCAGCTGTGGGG + Intergenic
1174279027 20:49424995-49425017 GCCTGGGGTCCCTGGCTGGTGGG + Intronic
1176839768 21:13828741-13828763 ATCCGGGGTCCCTGGGTGGGGGG - Intergenic
1177513494 21:22120298-22120320 GACCAGGTTCCCAAGCTGGGAGG + Intergenic
1179187207 21:39094109-39094131 GCCCCGTTTCCCTAGCTGGGAGG + Intergenic
1180868743 22:19134331-19134353 GGCCGGGGTCTTGAGGTGGGTGG + Exonic
1180996627 22:19969126-19969148 GGGCGGGGCCCCTAGCTGGCTGG + Exonic
1181169505 22:21000312-21000334 TGCCGGCCTCCCCAGCTGGGAGG - Exonic
1182946994 22:34333370-34333392 GGCCGAGGTGCCTGGCTTGGGGG - Intergenic
1183411790 22:37659169-37659191 GGCCGGGGACCCGAGCGCGGGGG + Exonic
1183704568 22:39468949-39468971 GGCAGCGGTTCCAAGCTGGGAGG + Intronic
1184151770 22:42643662-42643684 GGCCAGAGACCCCAGCTGGGTGG - Intronic
1185037534 22:48487641-48487663 GGCCTGGGACCCTGGCAGGGAGG - Intergenic
952673595 3:36000317-36000339 GGCCAGAGGCCCCAGCTGGGAGG + Intergenic
958650432 3:96930634-96930656 GGCCGGAGACCCGAACTGGGAGG + Intronic
958759583 3:98291617-98291639 GGCTGGAGGCCCTGGCTGGGAGG + Intergenic
959898040 3:111627445-111627467 GGCCAGAGGCCCTGGCTGGGAGG - Intronic
961120115 3:124366807-124366829 GGACGGGGTGGCTGGCTGGGCGG + Intronic
962736398 3:138329446-138329468 GGCCGGGGGCCGTAGGAGGGGGG - Intronic
963498412 3:146096769-146096791 GGACGGGGTGGCTGGCTGGGCGG - Intronic
966696460 3:182794086-182794108 GGCGGGAGTCCCGAGCGGGGTGG + Intronic
967574762 3:191077034-191077056 GGCTGGAAGCCCTAGCTGGGAGG - Intergenic
968453575 4:686410-686432 TGCCGGGGTCCCCAGCTGTTGGG + Intronic
968471514 4:784686-784708 GGTCGGGGGTCCTAGGTGGGAGG + Intergenic
969410385 4:7024363-7024385 GGTGGGGATCCCCAGCTGGGTGG - Intronic
973109233 4:46377873-46377895 GGACGGGGCGGCTAGCTGGGCGG - Intronic
977084461 4:92576159-92576181 GGCTGGAGACCCCAGCTGGGAGG + Intronic
978118457 4:105050036-105050058 GGCCGGAGACCCCAGCTAGGAGG - Intergenic
979273259 4:118787684-118787706 GGCCGTGGTCCCTATTTGGGTGG + Intronic
979967130 4:127088668-127088690 GGCCAGAGGCCCCAGCTGGGAGG - Intergenic
982993079 4:162304238-162304260 GGTTGGGTTTCCTAGCTGGGAGG + Intergenic
983664453 4:170166323-170166345 GGACGGGGTGGCTGGCTGGGCGG + Intergenic
985345712 4:189002148-189002170 GGCCAGAGGCCCTGGCTGGGAGG + Intergenic
985446007 4:190021707-190021729 GGCCGGGGTCCCCAGGTCGCCGG - Intergenic
985451377 4:190065578-190065600 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
985452367 4:190068871-190068893 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
985453352 4:190072168-190072190 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
985454342 4:190075461-190075483 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
985455330 4:190078754-190078776 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
985456318 4:190082054-190082076 GGCCGGGGTCCCCAGGTCGCTGG + Exonic
985457302 4:190085348-190085370 GGCCGGGGTCCCCAGGTCGCCGG + Intergenic
985458289 4:190088641-190088663 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
985459278 4:190091941-190091963 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
985463530 4:190174710-190174732 GGCCGGGGTCCCCAGGTCGCCGG + Exonic
986458004 5:7939964-7939986 GGCAGGGGTTCTGAGCTGGGTGG + Intergenic
987416002 5:17662902-17662924 GGCTGGAGGCCCTGGCTGGGAGG + Intergenic
992964037 5:81983258-81983280 GGACGGGGTGGCTGGCTGGGCGG + Intronic
992990503 5:82278398-82278420 GCGCGGGGTCCTTGGCTGGGCGG - Exonic
993579026 5:89636197-89636219 GCCCTGGGTCCCTGGTTGGGTGG - Intergenic
996778618 5:127159795-127159817 GGCTGGAGGCCCTAGCTGGGAGG + Intergenic
996778725 5:127160422-127160444 GGCTGGAGTCCCTGGCTAGGAGG + Intergenic
997625349 5:135327333-135327355 GGCCGGGACCCCAACCTGGGAGG + Intronic
998134748 5:139668677-139668699 TGCCGGGGTACCTGGCTTGGAGG + Intronic
999074317 5:148780393-148780415 GGCTGGAGGCCCCAGCTGGGAGG - Intergenic
999666339 5:153917083-153917105 GGCTGGAGGCCCTGGCTGGGAGG + Intergenic
1002088804 5:176792687-176792709 GGCCAGGTTTCCTACCTGGGAGG - Intergenic
1002967244 6:1978544-1978566 GGCTGGAGGCCCCAGCTGGGAGG - Intronic
1004516844 6:16327966-16327988 CACCGGGGTCCCTGGCTGCGGGG + Exonic
1005865485 6:29933132-29933154 GGACGGGGTGGCTGGCTGGGCGG - Intergenic
1006402702 6:33827027-33827049 GGCTGGGGTGGCTGGCTGGGAGG - Intergenic
1007774983 6:44219796-44219818 GGCCGGGGGGCCTGGCGGGGCGG + Intronic
1007775835 6:44223843-44223865 GGACCGGGACCCAAGCTGGGCGG + Exonic
1009289822 6:61868512-61868534 GGCTGGAGGCCCCAGCTGGGAGG + Intronic
1011137778 6:84118186-84118208 GGCTGGAGGCCCCAGCTGGGAGG + Intergenic
1011137833 6:84118450-84118472 GGCTGGAGGCCCTGGCTGGGAGG + Intergenic
1019340489 7:506752-506774 GGCCGGGGTCCCTAGCTGGGTGG - Intronic
1019786378 7:2980076-2980098 GCCCGTGGCCCCCAGCTGGGTGG - Intronic
1020039032 7:4987377-4987399 GGCTGGGGTCCCAGTCTGGGTGG - Intronic
1020325990 7:6975284-6975306 GGACGGGGCGGCTAGCTGGGCGG + Intergenic
1020382997 7:7566813-7566835 GGGCGGGGTCACTGGCCGGGAGG - Intergenic
1020702275 7:11498683-11498705 GGCTGGAGACCCTAGTTGGGAGG - Intronic
1021576778 7:22112377-22112399 TGCCAGGCTCCCTAACTGGGTGG - Intergenic
1022008918 7:26292126-26292148 GGCCGCCGTCCCCACCTGGGCGG - Exonic
1022465194 7:30648931-30648953 GGCCGGGCTCCCTGGCTGAAGGG + Intergenic
1023638795 7:42237910-42237932 GGCCGGGGTCGGGGGCTGGGGGG + Intergenic
1029440501 7:100584426-100584448 GGCCGGGGGCGGGAGCTGGGAGG + Intronic
1029501578 7:100933940-100933962 GGCAGGGCTCCCTGGATGGGTGG - Intergenic
1029507559 7:100971489-100971511 GGCCTGAGTCCCTGGCTGGGAGG - Intronic
1029625776 7:101719294-101719316 GGACTGGGGCCCGAGCTGGGAGG + Intergenic
1030438224 7:109552354-109552376 GGCTGGAGGCCCTGGCTGGGAGG - Intergenic
1031489370 7:122368547-122368569 GGCCTGGGGCCCTACCTGGGTGG - Intronic
1033757015 7:144403930-144403952 GGCCTGGGCTCCTGGCTGGGGGG - Intronic
1035027493 7:155835626-155835648 GGCATGGGGCCCGAGCTGGGCGG + Intergenic
1036688007 8:10924573-10924595 GGCCGTGGTCCCCAGGTGGAGGG + Intronic
1037281481 8:17246965-17246987 GGCCAGGCTCCCTGGCTGGCCGG + Exonic
1038429254 8:27486535-27486557 GGCCAGGGTCCCTGGCTGGCAGG - Intergenic
1039866683 8:41511301-41511323 GGCCAGGTGCCATAGCTGGGCGG - Intergenic
1041012579 8:53559065-53559087 GGCTGGAGTCCCAAGTTGGGAGG - Intergenic
1042489545 8:69381648-69381670 GGCCGGAGGCCCCAGCTTGGAGG - Intergenic
1046198509 8:110892683-110892705 GGCCGAGGTGCCTGGCTCGGTGG - Intergenic
1048469550 8:134695195-134695217 GGCCGGGGTGCCTCCCGGGGAGG - Intronic
1049324503 8:142014988-142015010 GGCTGGGGTCCAGGGCTGGGCGG + Intergenic
1052569223 9:30199275-30199297 GGCCGAGGTGCCTGGCTTGGGGG + Intergenic
1053352846 9:37424767-37424789 GGCCAGGATTCCCAGCTGGGAGG + Intronic
1053786338 9:41655236-41655258 GGCCGGGGTCCGGGGCCGGGAGG + Intergenic
1056907571 9:90666533-90666555 GGCTGGAGGCCCCAGCTGGGAGG + Intergenic
1058199993 9:102027679-102027701 GGCTGGAGACCCTAGTTGGGAGG + Intergenic
1058661540 9:107272175-107272197 GGACGGGGTGGCTGGCTGGGCGG - Intergenic
1060205176 9:121678610-121678632 GGCAGGAGGCCCTAGCTGTGTGG + Intronic
1060348516 9:122837614-122837636 GGCCAGGCACCGTAGCTGGGCGG - Intergenic
1060769931 9:126325916-126325938 GCCTGGGGTGCCTGGCTGGGCGG + Intergenic
1061233992 9:129331872-129331894 GGCAGGGCTCCCTGGTTGGGAGG + Intergenic
1062339863 9:136089218-136089240 GGGTGGGGTCCCCAGCTGGGAGG - Intronic
1062426423 9:136508195-136508217 GGGCTGGGACCCGAGCTGGGTGG + Intronic
1062610115 9:137369738-137369760 GGCCGTGCTCCCCAGGTGGGTGG + Intronic
1203736638 Un_GL000216v2:144151-144173 GGCCGGGGTCCCAAGGTCGCCGG + Intergenic
1186593254 X:10953386-10953408 GGCCGGAGGCCCTGGCTGGGAGG - Intergenic
1188901056 X:35733694-35733716 GGCCAGAGGCCCTGGCTGGGAGG + Intergenic
1189581644 X:42413526-42413548 GGCTGGGGACCCTGGTTGGGAGG + Intergenic
1190803411 X:53813457-53813479 GGCCAGAGGCCCCAGCTGGGAGG + Intergenic
1190803481 X:53813739-53813761 GGCTGGAGTGCCTGGCTGGGAGG + Intergenic
1191019336 X:55842714-55842736 GGCAGGAGTCCCTTGTTGGGAGG + Intergenic
1191209617 X:57871499-57871521 AGCCAGAGTCCTTAGCTGGGAGG + Intergenic
1191743874 X:64464868-64464890 GGCTGGAGACCCTAGTTGGGAGG + Intergenic
1191988759 X:67009893-67009915 GGCTGGAGACCCTAGTTGGGAGG - Intergenic
1192252227 X:69422371-69422393 GGACGGGGTGGCTGGCTGGGCGG - Intergenic
1192558794 X:72111180-72111202 GGCCGGCCACCCTACCTGGGTGG + Intergenic
1192891725 X:75398387-75398409 GGCCGGAGGCCCTGGTTGGGAGG - Intronic
1192926271 X:75758414-75758436 GGCTGGAGACCCTAGTTGGGAGG - Intergenic
1193933007 X:87580888-87580910 GGCTGGAGGCCCTAGCTGGGAGG - Intronic
1194867514 X:99086611-99086633 GGCTGGAGTCCCTGGATGGGAGG - Intergenic
1194953442 X:100153267-100153289 GGCCGGAAGCCCCAGCTGGGAGG + Intergenic
1194953501 X:100153535-100153557 GGCTGGAGGCCCCAGCTGGGAGG + Intergenic
1197122193 X:122906160-122906182 GGCTGGGGACCCTGGTTGGGAGG - Intergenic
1197897072 X:131327444-131327466 GGACGGGGTGGCTGGCTGGGCGG - Intronic
1199637881 X:149830415-149830437 GGCGGTGGACCCTTGCTGGGAGG + Intergenic
1200173736 X:154097558-154097580 GGGCGGGGACCCTTGCCGGGGGG - Intronic
1201696406 Y:16831918-16831940 GGCCGGAGTCCCCCGCAGGGAGG - Intergenic