ID: 1019340491

View in Genome Browser
Species Human (GRCh38)
Location 7:506756-506778
Sequence GACTGGCCGGGGTCCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340491_1019340498 -4 Left 1019340491 7:506756-506778 CCAGCTAGGGACCCCGGCCAGTC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1019340498 7:506775-506797 AGTCACTCCCCCAGGGCTGCCGG 0: 1
1: 0
2: 0
3: 17
4: 252
1019340491_1019340506 25 Left 1019340491 7:506756-506778 CCAGCTAGGGACCCCGGCCAGTC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data
1019340491_1019340505 24 Left 1019340491 7:506756-506778 CCAGCTAGGGACCCCGGCCAGTC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340491_1019340503 11 Left 1019340491 7:506756-506778 CCAGCTAGGGACCCCGGCCAGTC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340491 Original CRISPR GACTGGCCGGGGTCCCTAGC TGG (reversed) Intronic
900104349 1:975988-976010 GAGTGGCCGTGGTCACTGGCTGG + Exonic
900173232 1:1280830-1280852 GTCTGGCCGGTGTCCCCTGCTGG - Intronic
900202695 1:1418267-1418289 GGCTGGCCGGAGTCCCCCGCAGG + Intergenic
900390182 1:2430448-2430470 GACTGGCTGGGATCACCAGCTGG - Intronic
901563838 1:10095687-10095709 GACTGGCATGGGTCTCTAGCTGG - Intronic
904576005 1:31505462-31505484 GACTGTCCTGGGTCCTCAGCCGG - Intergenic
918276801 1:182960279-182960301 GACTGGCGGAGGGCCATAGCTGG + Intergenic
920308341 1:205032986-205033008 GCCTGCCCAGGGCCCCTAGCAGG + Intergenic
923146617 1:231202942-231202964 GACTGGATGGGGTCACTGGCTGG + Intronic
924179287 1:241424527-241424549 CACTGGGCAGGGTCGCTAGCAGG + Intergenic
1063505331 10:6593027-6593049 AGATGGCCGGGGTACCTAGCAGG + Intergenic
1067730279 10:48805596-48805618 GACAGGCCGGTTTCCCCAGCAGG + Intronic
1068811144 10:61257213-61257235 GAGTGGCCAGAGGCCCTAGCTGG + Intergenic
1068950186 10:62769078-62769100 GACAGGCTGAGGTCCCTAGACGG - Intergenic
1069119981 10:64557350-64557372 GACTGGCCATGGTTCTTAGCAGG + Intergenic
1069725291 10:70573648-70573670 GACTGGCCAAGGTCCCCAGCAGG - Intergenic
1072806392 10:98426195-98426217 GTCTGGCCCGGGTGCCAAGCAGG + Intronic
1076687472 10:132204561-132204583 GACTGGCCCGGGTTCCTCTCGGG + Intronic
1077843028 11:5995073-5995095 GACTGGCCGGGTGCCATAGCTGG + Intergenic
1083305855 11:61761614-61761636 GCCTGGCCGAGGTCCCTCACTGG + Intronic
1083937482 11:65877618-65877640 GACTGGCTGGGGCCCATAACTGG + Intergenic
1084473262 11:69375255-69375277 GACTCCCTGGGGTCCCTAGGTGG + Intergenic
1089198763 11:116710865-116710887 GGCTGGCAGGGGTGCCAAGCAGG + Intergenic
1093690515 12:22103287-22103309 GACTGGCTGGGTTCCCAAGCCGG + Intronic
1096464561 12:51841128-51841150 GACCGGCCGGGCTGCATAGCTGG - Intergenic
1096575466 12:52549962-52549984 GACTGCCAGGGGTCCCTTGGAGG + Intronic
1096634387 12:52949238-52949260 GACCGGCCGGGCGCCGTAGCTGG - Exonic
1098024732 12:66189505-66189527 GCATGGCTGGGGTCCCTCGCGGG + Intronic
1101469068 12:104977941-104977963 GACTGGCCAGGCGCCATAGCTGG + Intergenic
1103474728 12:121210095-121210117 GACTGGGCGGGGCTCCGAGCGGG + Exonic
1104993393 12:132639602-132639624 GACGGGCCGGGGACCCTGACAGG + Intronic
1105695467 13:22884118-22884140 GGCTGGCCGGAGTCCCCTGCAGG - Intergenic
1105700375 13:22931420-22931442 GACTTTCCTGGGTCTCTAGCTGG - Intergenic
1119559443 14:75578591-75578613 GACTGGGCGAGGCCCCAAGCTGG + Intergenic
1120830054 14:88989911-88989933 TACTGCCAGGGGTCCCTAACTGG + Intergenic
1121255239 14:92525886-92525908 GAGTGCCGGGGGTCCCTGGCTGG + Intronic
1122110652 14:99498765-99498787 GACTTGCCTGGGTCCCTGGGTGG - Intronic
1122153020 14:99734777-99734799 GACTGGCGTGAGTCCCTCGCTGG - Intergenic
1131057675 15:89385246-89385268 GACTGACCCTGGTCCCTTGCTGG - Intergenic
1131260336 15:90884478-90884500 AACTGGCCGGGGTCCGCACCGGG + Exonic
1132698621 16:1212839-1212861 GACTGGCCGCGGGCCCTCTCCGG + Intronic
1132730047 16:1356665-1356687 GCCTGGCCTGGCTCCCCAGCTGG - Intronic
1136540883 16:30927226-30927248 ACCTGGCCAGGGTCCCTAGAAGG + Intronic
1138440101 16:57029277-57029299 GCCTTGCCTGGGTTCCTAGCTGG - Intronic
1139921073 16:70460996-70461018 GCCTGGCTGGGATCTCTAGCTGG + Intronic
1140181878 16:72728679-72728701 GACTGGCCGGGCACTGTAGCTGG - Intergenic
1144786760 17:17836484-17836506 GCCGGGCCGGGGTCCCTTGGCGG - Intronic
1144930970 17:18858365-18858387 GACGGGTCGGGGTCCCTGGGTGG + Intronic
1149936247 17:60810230-60810252 GACTGGCTGGGTGCCATAGCTGG - Intronic
1151305566 17:73260899-73260921 GACAGGCCTGGGCCCCAAGCTGG - Intronic
1151669637 17:75564999-75565021 GGCTGGGCTGGGTCTCTAGCTGG - Intronic
1154241373 18:12657337-12657359 GGCTGGCCGGGGCCCCTCGGAGG - Intronic
1160778840 19:868932-868954 GGCTGGCCTGGGGCCCTGGCGGG + Exonic
1161301023 19:3543385-3543407 GGCTGGCCGGGGCCCGTGGCAGG - Exonic
1161722142 19:5909023-5909045 GGGTGGCCGGGGTCACTGGCCGG - Exonic
1163089621 19:15010783-15010805 GCCTGGCCGGGAACCCTAGGCGG - Exonic
1164747433 19:30626798-30626820 CGCTGGCCGGGATCCCTATCTGG - Intronic
1165274270 19:34734368-34734390 TACTGGCCGGAGTCCTCAGCAGG - Intronic
1165352354 19:35282677-35282699 CAGTGGCCTGGGTCCTTAGCAGG + Intronic
1165956102 19:39503087-39503109 GAGGGGCCGGGGTCCCCGGCTGG - Intronic
1166678704 19:44754658-44754680 GCCTGGCCTGGGTCCCTCTCGGG - Intronic
926491754 2:13532986-13533008 GGCTGGTCGGAGTCCCCAGCAGG + Intergenic
932457971 2:71861699-71861721 GACTGGGCGGGGCCCTGAGCAGG - Intergenic
934716832 2:96549493-96549515 GCCTGGGCGGGGTCCCCTGCTGG - Intronic
943548752 2:189312452-189312474 GACCGGCCGGGCGCCGTAGCTGG + Intergenic
946195307 2:218029092-218029114 GGCAGGCCTGAGTCCCTAGCAGG - Intergenic
948096847 2:235342237-235342259 GACTTGCCGGAGTCACAAGCTGG - Intergenic
948198105 2:236110086-236110108 CACTGCCCAGGGTCCCCAGCTGG - Intronic
948679995 2:239627174-239627196 GGCTGGCCAGGGTCCCCGGCGGG + Intergenic
1170401225 20:15985657-15985679 GGCTGGCCGGAGTCCCCCGCAGG + Intronic
1171456920 20:25277391-25277413 GGCTGGCCGGGCTCCCCAGTGGG + Intronic
1174349489 20:49956807-49956829 GACCGGCCGGGCGCCATAGCTGG - Intergenic
1175514161 20:59558317-59558339 GGCTGGCCGGAGTCCCCCGCAGG + Intergenic
1178883592 21:36467389-36467411 GACTGCCTGGGGTCCCTCCCTGG + Intronic
1179141335 21:38728043-38728065 CACTGGCCTGGGTCCTCAGCAGG + Intergenic
1181299329 22:21867983-21868005 CACAGCCCGGGGTCCCTCGCTGG - Intergenic
1183726090 22:39590425-39590447 CACAGGCCTGGGTCCCCAGCAGG + Intronic
1183758217 22:39790604-39790626 GACTGGCCTGTGCCCCAAGCTGG - Intronic
1183979454 22:41531109-41531131 GTCTGGCCGTGGTGCCTGGCTGG - Intronic
950042360 3:9928424-9928446 GGCTGGCAGGGGTCCCCACCCGG - Exonic
950203734 3:11062270-11062292 GACTGGAAGGGGACCCGAGCAGG - Intergenic
952827969 3:37539826-37539848 GACTGCCAGGGTTCCCCAGCAGG - Intronic
958814616 3:98901739-98901761 GATTGGCCGCGGTGCCTAGGGGG - Intergenic
961356212 3:126341576-126341598 GACTGGCCATGGTCCCGAGGAGG - Intergenic
968550799 4:1222609-1222631 GCCTGGGCGGGGGCCCTGGCAGG + Intronic
969559187 4:7935766-7935788 CCCTGGCCGGGGTCCCAAACAGG - Intronic
972538634 4:40020304-40020326 GACTGGCCGAGCGCCGTAGCTGG - Intergenic
982662970 4:158228641-158228663 GGCTGGTCGGAGTCCCTCGCAGG + Intronic
987930809 5:24397606-24397628 GGCTGGCCGGAGTCCCCTGCAGG + Intergenic
992989839 5:82273173-82273195 GGCTGGCCGGAGTCCCCCGCAGG + Intronic
995215268 5:109588403-109588425 GACTGGCAGGGAACCGTAGCTGG - Intergenic
1001314304 5:170631800-170631822 GACTGGCCCAGGTCTCTAGTGGG - Intronic
1001579952 5:172791635-172791657 GACTGGCCAAGGTGCCCAGCAGG + Intergenic
1005761311 6:28970331-28970353 GACTGGCTGGGAACCGTAGCTGG + Intergenic
1008837087 6:55847025-55847047 GACTGGTCTGGGCCCCTTGCTGG - Intronic
1013559450 6:111290034-111290056 GGCTGGCCGGAGTCCCCCGCAGG + Intergenic
1019340491 7:506756-506778 GACTGGCCGGGGTCCCTAGCTGG - Intronic
1021199573 7:17712867-17712889 GACTGGCCGGCCTCCATAGTTGG + Intergenic
1023850121 7:44145811-44145833 GGCTGGCCGGGGCCCCTCCCTGG - Intronic
1024059019 7:45684375-45684397 GACTAGTCGGGGACTCTAGCAGG + Intronic
1028111904 7:86950709-86950731 TACTGGCCTGGGTCCCACGCTGG - Intronic
1035163146 7:156966105-156966127 GACAGGGCTGGGCCCCTAGCTGG + Intronic
1036642575 8:10593355-10593377 CACTGGACTGGGTCCCCAGCAGG + Intergenic
1040993678 8:53379206-53379228 GGCTGGTCGGAGTCCCTTGCAGG + Intergenic
1041878073 8:62712868-62712890 AACTGGCTGGGTTCCCTAGCAGG - Intronic
1049557731 8:143291402-143291424 GACGGGGCGGGGACCGTAGCGGG + Exonic
1050722295 9:8604510-8604532 GTATGGCCAGGGTCCCTTGCTGG - Intronic
1055708943 9:79037612-79037634 GACAGGCCGGGCGCCGTAGCTGG + Intergenic
1057275478 9:93674029-93674051 GACTGGCCGGGGCCCACATCTGG + Intronic
1057699658 9:97354710-97354732 GCCTGGCTGGGGGCCCTACCTGG - Exonic
1058528650 9:105885061-105885083 GCCAGGCCAGGGTCCCTGGCAGG - Intergenic
1060271259 9:122143700-122143722 GAATGGGAGGGGCCCCTAGCAGG - Intergenic
1061092465 9:128434290-128434312 GGCCGGCCAGGGTCCCAAGCAGG - Intronic
1061741389 9:132708817-132708839 GACTCGCCGGGGGTCCCAGCTGG - Intergenic
1062301875 9:135878169-135878191 TCCTGGCCGGGGTCCCTACCTGG - Intronic
1062519167 9:136950492-136950514 GCATGGGCGGGGTCCGTAGCGGG + Intronic
1062580585 9:137227631-137227653 CACTGTCTGGGGTCCCGAGCTGG + Exonic
1186694588 X:12016819-12016841 GACAGGCTGAGGTCCATAGCTGG - Intergenic
1190315592 X:49148539-49148561 AACTGGCCGGAGTCCCCTGCAGG + Intergenic
1193850836 X:86535763-86535785 GCCTGGAAGGGGTCCCGAGCAGG + Intronic
1194321892 X:92459731-92459753 GACCGGCCGGGCGCCGTAGCTGG - Intronic
1200630061 Y:5573209-5573231 GACCGGCCGGGCGCCGTAGCTGG - Intronic
1201076820 Y:10195612-10195634 GACGGGGCGGGGGCCCTTGCGGG + Intergenic
1201372730 Y:13282856-13282878 GGCTGGCCGGAGTCCCCTGCAGG - Intronic
1201696408 Y:16831922-16831944 GGCTGGCCGGAGTCCCCCGCAGG - Intergenic