ID: 1019340492

View in Genome Browser
Species Human (GRCh38)
Location 7:506767-506789
Sequence CCTGGGGGAGTGACTGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340492_1019340505 13 Left 1019340492 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340492_1019340508 25 Left 1019340492 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1019340508 7:506815-506837 ATCCCAGCAGGGTCTGTGCCAGG No data
1019340492_1019340506 14 Left 1019340492 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data
1019340492_1019340503 0 Left 1019340492 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340492 Original CRISPR CCTGGGGGAGTGACTGGCCG GGG (reversed) Intronic
900310760 1:2032179-2032201 CCTGGGGGTGGGACAGGCTGGGG + Intergenic
900313456 1:2045879-2045901 CCCGGGGGAGAGGCTGGCCCCGG - Intergenic
900537940 1:3187991-3188013 CCTTCGGGAGAGACTGGCCAGGG + Intronic
901659465 1:10789328-10789350 CCTGGGGAAGTGGCAGGCCCAGG - Intronic
901828848 1:11879950-11879972 CCTGGGTGTGTGACTGCCGGAGG + Intergenic
902674737 1:18000907-18000929 CTGGGGAGAGTGACTGGCCTGGG + Intergenic
903212359 1:21825490-21825512 CTTGGGCGAGTGACTGGCCCAGG + Intronic
903266071 1:22158861-22158883 GCTGAGGGACTGACTGGTCGAGG + Intergenic
903857581 1:26345893-26345915 CCTGGGCAGGTGACTGGCAGGGG + Exonic
903967446 1:27099602-27099624 GCTAGGGGAAGGACTGGCCGTGG - Exonic
904457659 1:30657245-30657267 GCTGGGGGAGGGGCTGGCCCCGG + Intergenic
904499043 1:30903582-30903604 CCTGTGGGAGGGATTGGCCAGGG - Intronic
904619521 1:31766854-31766876 CCTGGGGCAGAGACTGGGCATGG + Intergenic
904629128 1:31828450-31828472 TCTGGGGGAGTGGTTGGCAGGGG + Intergenic
905105711 1:35562442-35562464 CCTGGGTGCCTGGCTGGCCGAGG + Exonic
905515433 1:38558850-38558872 CCTGGGGAACTGACGGGCCCTGG + Intergenic
906557907 1:46728886-46728908 CCTGGGGGAAGGAGTGGCTGTGG + Intergenic
906639957 1:47435880-47435902 CCTGGGTGACAGACTGTCCGGGG - Intergenic
907477563 1:54715761-54715783 CCTGGGGGCGTGGCCGGGCGTGG - Intronic
908006599 1:59734715-59734737 CCTGGGGGAGGGGATGGCCCTGG + Intronic
909622522 1:77683606-77683628 CCAGGGGCAGGGACTGGCCGGGG - Intergenic
911565735 1:99461613-99461635 CCTGGGGGAGGGGCTGGCCAAGG - Intergenic
912494997 1:110085867-110085889 CCTGGGGAGGTGCCTGGTCGTGG - Intergenic
913688055 1:121252844-121252866 CCTGGAGCAGTGACTGGTCAGGG + Intronic
914039912 1:144040484-144040506 CCTGGAGCAGTGACTGGTCAGGG + Intergenic
914149547 1:145027436-145027458 CCTGGAGCAGTGACTGGTCAGGG - Intronic
914747154 1:150509214-150509236 CCTGAGGGAAAGACTGGCAGAGG + Intronic
915723161 1:157998787-157998809 CCTGGGGAACTGCCTGGCCTTGG + Intronic
916353592 1:163879629-163879651 GCTGAGGGAGTGACCGGCCGAGG - Intergenic
920252442 1:204630683-204630705 CCTGGGGAAGGGAATGGCCAGGG - Intronic
920475377 1:206271343-206271365 CCTGGAGCAGTGACTGGTCAGGG + Intronic
923226128 1:231940361-231940383 CTCGGGAGAGTGCCTGGCCGGGG - Intronic
923344749 1:233040820-233040842 ACTGTGGGAATGACTGGCTGAGG - Intronic
1066292364 10:34026107-34026129 CCTTGGGGAAGGACTGGCTGTGG + Intergenic
1067228084 10:44388199-44388221 CCTGGAGGAGTGAACGGCCCAGG - Intergenic
1067616726 10:47762838-47762860 CCTGGGCCAGGGACTGGCTGGGG - Intergenic
1067694411 10:48524412-48524434 CCCGGGAGAGTAACGGGCCGTGG - Intronic
1070288843 10:75101866-75101888 CCTGTGGGAGTATCTGGCCCAGG + Intronic
1072621739 10:97084261-97084283 CCTGGGGGAGAGCATGGCTGTGG - Intronic
1073321079 10:102616641-102616663 CCTGGGGGAGGGGCAGGCAGGGG - Intronic
1075476706 10:122741636-122741658 TCTGGGAGAGAGACAGGCCGGGG + Intergenic
1075723303 10:124599482-124599504 CCTGGAGGCGGGACTGGCAGAGG - Intronic
1075733451 10:124649949-124649971 CCTGGGCAAGTGACTGCCCTGGG - Intronic
1075776236 10:124990723-124990745 CCTTGGGAAGTGACTGGGTGAGG + Intronic
1076199812 10:128549065-128549087 TCTGAGGAAGTGACTGGCCTAGG - Intergenic
1076284352 10:129278517-129278539 CCAGGGGCAGTGACAGGCCTAGG - Intergenic
1076521528 10:131084338-131084360 CCTGGGAGAGACACTGGCAGAGG + Intergenic
1077633200 11:3824821-3824843 TCTGGGGGAGTGATGGGCCGAGG - Intronic
1079076642 11:17388887-17388909 CCTGGAGGAGAGACGGGGCGGGG - Intronic
1080376891 11:31723340-31723362 CCTGGGGGAGTGGGTGGCGGGGG - Intronic
1080641812 11:34162726-34162748 CCTGGAGGAGATCCTGGCCGAGG - Exonic
1081549309 11:44096587-44096609 CCCGGGGGTGTGTCGGGCCGGGG + Intronic
1083499227 11:63087953-63087975 CCTGGGGGAAGGAGTGGCTGTGG + Intronic
1083712966 11:64560063-64560085 GCTGGGGGAGTGAGGGGGCGTGG - Intronic
1083760971 11:64817514-64817536 ACTGTGGGAGTGAGTGGCTGAGG + Intergenic
1083849111 11:65355023-65355045 CGAGGGGGAGTGACCGGCCAGGG + Intronic
1083954555 11:65976373-65976395 CCTGGGGGAGGGAGCGGCTGTGG - Exonic
1084006787 11:66327223-66327245 CCTGGAGGAGACACTGGCCCAGG - Intergenic
1084030198 11:66476471-66476493 CCTGGGGGAGTGAAGGGGCCAGG + Exonic
1084178475 11:67435253-67435275 CCTGGGGGTGTGTCTGGGGGTGG + Exonic
1084418606 11:69049121-69049143 CCTGGGGAGGGGACTGGCCCGGG + Intronic
1084547975 11:69823874-69823896 CCAGGTGGAGGGACTGGCCTGGG - Intergenic
1084858812 11:72005125-72005147 CCTGGATCACTGACTGGCCGAGG - Intronic
1085325537 11:75603581-75603603 CCTGGGGCAGTGAGTGGGGGCGG + Intronic
1085564536 11:77501327-77501349 CCGGGTGGAGTGAAGGGCCGGGG - Intergenic
1088244971 11:107809048-107809070 ACTTGGAGAGTGACTGGCTGGGG - Intronic
1088788940 11:113207310-113207332 CCAGGGTGACGGACTGGCCGAGG - Exonic
1089025051 11:115260479-115260501 CCTGGTGGCCTGAATGGCCGAGG + Intronic
1089556296 11:119317366-119317388 TCTCGGGGTCTGACTGGCCGAGG + Intronic
1089609209 11:119660255-119660277 CCTGGGGGTGGGAGTGGCAGGGG - Intronic
1089685588 11:120144683-120144705 CCTGAGGGACTGGCTGGCTGTGG + Intronic
1090159136 11:124472896-124472918 CTTGGAAGAGTGACTGGCCGTGG - Intergenic
1090264001 11:125342768-125342790 TCTGGGGGAGGGGCGGGCCGGGG + Intronic
1090416573 11:126544518-126544540 ACTGGGGGTGGGACTGCCCGGGG + Intronic
1091796969 12:3303123-3303145 TCTGGGGGAGAGACTGACTGTGG + Intergenic
1091923199 12:4321759-4321781 CCTGGGGGGCTGACTGCCTGGGG - Intronic
1094494958 12:30983318-30983340 TCTGGGGGAGAGACTGACCGTGG - Intronic
1096282219 12:50266010-50266032 CCTCGGTCAGTGACTGGCCAGGG + Intronic
1101426608 12:104593364-104593386 CCTGTGGGAGGGACTGGGTGAGG + Intronic
1101755539 12:107618215-107618237 CCTGGAGGAGATTCTGGCCGAGG + Exonic
1102250727 12:111385603-111385625 CCTGGGGGAGTCCCTGGTCATGG + Intergenic
1103447254 12:121002233-121002255 CCTGGGGGCCTGGCTGGCTGAGG + Exonic
1104910220 12:132236719-132236741 CCAGGAGGCGTGGCTGGCCGAGG - Intronic
1107305155 13:39010938-39010960 CCTGGGGGAGTTACTACCCTTGG - Exonic
1108998350 13:56763688-56763710 CCTGGGGGAAGGAGTGGCTGTGG + Intergenic
1109626587 13:64982615-64982637 CCTGGGGGAAGGAGTGGCTGTGG - Intergenic
1112032862 13:95473502-95473524 CCTGGGGTGGTGAGCGGCCGAGG - Intronic
1113792188 13:113034805-113034827 CCTTGGGGAGTGACAGTCCCCGG + Intronic
1114421780 14:22589759-22589781 CTTGGGGGAGTGAGTGGGTGTGG + Intergenic
1114569817 14:23658827-23658849 GCTGGGGGAGTGGCTGCCCATGG + Intergenic
1116784441 14:49271540-49271562 CCTGTGGAAGTGACTTGCCCAGG - Intergenic
1121103301 14:91264557-91264579 CCCGCGGGAGGGAGTGGCCGCGG + Intergenic
1121114571 14:91334773-91334795 CTGGAGGGAGTGACTGGCCCAGG + Intronic
1121469918 14:94144737-94144759 CCTGGGGGAGTGAGGGGGTGGGG + Intergenic
1122187074 14:100007591-100007613 GCTGTGAGAGTGACTGGCCAAGG + Intronic
1122444756 14:101760914-101760936 CCGAGGGGAGGGGCTGGCCGAGG + Intergenic
1122938049 14:104968910-104968932 CCTGTGGGAGTCACTGCCCTCGG + Intronic
1123735553 15:23179934-23179956 ACTGGGGGCGCGGCTGGCCGGGG - Intergenic
1124286269 15:28402917-28402939 ACTGGGGGCGCGGCTGGCCGGGG - Intergenic
1124296434 15:28508719-28508741 ACTGGGGGCGCGGCTGGCCGGGG + Intergenic
1124580922 15:30954172-30954194 CCTGGGGGAGGGCCTTGCAGGGG - Intronic
1125532122 15:40420506-40420528 CCTTGGAGAGTGGCTGGCCCAGG + Intronic
1129169644 15:73799759-73799781 CATGGGGAAGAGACTGGCCTGGG - Intergenic
1129694053 15:77730639-77730661 CCTGGGGGAGACACAGGCAGAGG + Intronic
1130041330 15:80407204-80407226 CGTGGGGAGGTGACTGGCTGTGG - Intronic
1130086210 15:80779971-80779993 CCCGGGAGAGTGTCTCGCCGAGG + Intronic
1130768053 15:86893061-86893083 CCTGGGTGAGTGAGTCCCCGAGG - Intronic
1130979291 15:88802158-88802180 CCTGGGGGCGGGACTGGCCCTGG - Intergenic
1132622689 16:875240-875262 CCTGGTGGGGTGAGTGGCGGTGG - Intronic
1132673081 16:1109717-1109739 CCTGGGGAAGTCCCAGGCCGCGG + Intergenic
1132735217 16:1382528-1382550 CCTGAGGGAGGGACTGGCCCTGG + Intronic
1132767816 16:1543437-1543459 CCAGGGGAAGTGACTTGCCCAGG - Intronic
1132775737 16:1592839-1592861 CCTGACGGAGTCACTGGCGGAGG + Intronic
1132775751 16:1592903-1592925 CCTGGCAGAGTGACTGGTGGAGG + Intronic
1132775775 16:1592999-1593021 CCTGGCAGAGTGACTGGTGGTGG + Intronic
1132775782 16:1593031-1593053 CCTGGCAGAGTGACTGGTGGTGG + Intronic
1132775789 16:1593063-1593085 CCTGGCAGAGTGACTGGTGGAGG + Intronic
1132974745 16:2705676-2705698 CCTGTGGGGGTGTCTGGCCATGG + Intronic
1136590428 16:31214957-31214979 CCTGGTGGAGGGGCTGGCCCAGG + Exonic
1136664751 16:31800267-31800289 CCTGGGGTAGTGACTGGGAAGGG + Intergenic
1138262929 16:55638350-55638372 CAAGAGGGAGTGACTGGCCATGG - Intergenic
1141410265 16:83828371-83828393 CCTGGGGGAGTGAGGGGTCCAGG - Intergenic
1141890616 16:86924427-86924449 CCAGGGGAAGGGACTTGCCGGGG - Intergenic
1142126080 16:88411360-88411382 CCAGGGGGAGTGGCGGGCAGGGG + Intergenic
1143107487 17:4536878-4536900 CCTGGGGGAGAGACGGGCGGGGG - Exonic
1143606533 17:7990052-7990074 ACCGGGGGACTGACTGCCCGAGG + Intergenic
1143947341 17:10604964-10604986 ACTGGGGGTGGGACTGGCCTGGG - Intergenic
1144729166 17:17516873-17516895 CCTGGGGTAGCCACTGGGCGGGG - Intronic
1144912606 17:18695630-18695652 CCTGGGGGGGTGTCTGCCTGGGG - Intergenic
1146513782 17:33473182-33473204 CCTGGGGCAGGGACTGGCATGGG + Intronic
1146727362 17:35167108-35167130 CAGAGGGGAGTGACTGGCCCAGG + Intronic
1146798539 17:35800149-35800171 CCCAGGGGAGTGTCTGGCAGTGG + Intronic
1149585488 17:57783355-57783377 CCTGGGGGTGTGGGTGGCGGGGG + Intergenic
1150285917 17:63954059-63954081 CCTGGGGGAGTGAGAGGGCATGG + Intronic
1151163112 17:72182657-72182679 CATGGGGAAGTGGCTGGCAGTGG - Intergenic
1151431714 17:74067909-74067931 CCTGGAGGAGGGACTGGCCCAGG - Intergenic
1152289143 17:79429000-79429022 TCTGGGGGAGTCACTGGCAGGGG - Intronic
1152538398 17:80963180-80963202 CCTGAGGGAGGGACTTGCCTGGG + Intronic
1152624708 17:81382984-81383006 CCTGGGGGAGGGGCTGCCCCAGG - Intergenic
1152776821 17:82207064-82207086 CCAGGTGCAGTGACTGGCCCCGG + Intronic
1152789751 17:82272911-82272933 CCTGGGGGAGGGGCAGGGCGGGG - Intronic
1152790966 17:82279361-82279383 CCTGGGGCAGAGCCTGGGCGTGG - Intergenic
1152898261 17:82925889-82925911 CCTGGGGTGGGGGCTGGCCGTGG + Intronic
1153300089 18:3584680-3584702 CCTGGGTGGATGACTGGCAGAGG + Intronic
1153323882 18:3798504-3798526 CCTGGGGGATTGACTTGGAGAGG + Intronic
1153973668 18:10248085-10248107 CCTCGGGGAGAGTCTGGCCAGGG + Intergenic
1155218383 18:23662787-23662809 CCCGGGAGAGTGAAGGGCCGGGG - Exonic
1158040233 18:53084537-53084559 CCTGGAGGAGCAACTGGCTGAGG - Intronic
1159420745 18:68216377-68216399 CCTGGGGGTGGGACTGGGAGTGG + Intergenic
1160745743 19:709997-710019 CCTGTGGGAGTGAGGGGCAGAGG - Intronic
1160750096 19:729900-729922 GCAGTGGGAGTTACTGGCCGTGG + Intronic
1160782472 19:883948-883970 CCTGGGGGAAGGAATGGCAGTGG + Intronic
1160817581 19:1043247-1043269 CCTGAGTGAGTGACTGACCTCGG + Exonic
1161163156 19:2771815-2771837 CCTTGGGGAGGCCCTGGCCGTGG + Intronic
1161321251 19:3642585-3642607 CCTGGGGAGGGGACAGGCCGTGG + Intronic
1161428494 19:4217410-4217432 CCTGGGGAAGTGCGAGGCCGCGG + Exonic
1161777603 19:6272109-6272131 TCTGAGGGAGTGACAAGCCGTGG - Intronic
1162124736 19:8493408-8493430 CCTGGTGGAGTGACTGCTCACGG - Intronic
1162208792 19:9075599-9075621 CCTGGGGGAGTTCCAGGCTGGGG + Intergenic
1162717764 19:12644627-12644649 CCTATGGTAGTGACTGGCCTGGG - Intronic
1162749163 19:12817843-12817865 CCTGAGGAACTGACTGGCAGAGG + Intronic
1163511677 19:17739332-17739354 CCTGGAGGAGGGACCGGCAGAGG + Intergenic
1164609072 19:29620160-29620182 CCTGGAGGAGGGACTGGCTTAGG + Intergenic
1164903531 19:31948200-31948222 CCTTGGGGAGTGACTGGCTTAGG - Intergenic
1165406469 19:35633981-35634003 CCTGGGGGTGGCTCTGGCCGAGG - Exonic
1168450189 19:56460389-56460411 CCTGGGGGGATGAGTGGCCAGGG + Intronic
926077536 2:9952626-9952648 CATGGGGGATTAACTGGGCGAGG + Intronic
927207269 2:20618473-20618495 CCTGGGTGACTGACTGGCCTGGG - Exonic
928108087 2:28485619-28485641 CCTGGGGGAGTGACTGAAGTGGG + Intronic
928420167 2:31132112-31132134 CCTGGGGGAGAGAGTGGGCTAGG + Intronic
928728749 2:34206516-34206538 CCTGGGGGAATGGCTGTCCTTGG - Intergenic
929490784 2:42394368-42394390 CCTGTGGGAGGGAATGGCTGAGG - Intronic
931253767 2:60553827-60553849 CCCGGGGGAGGGGCGGGCCGAGG + Intergenic
932406763 2:71518082-71518104 CCTGGGGGAGGGAGAGGCAGTGG + Intronic
936542310 2:113362268-113362290 ACTGGGGAGGTGACAGGCCGAGG - Intergenic
937052362 2:118902794-118902816 CCTATGGGAGCGAGTGGCCGAGG - Intergenic
937335518 2:121059918-121059940 CCGGGGGAAGTGCCTGGCCTTGG + Intergenic
941106881 2:161364369-161364391 CATGGGGGAGTGGCAGGCCAGGG + Intronic
941116697 2:161480266-161480288 CCTGGGGGCGTGTCTGCCAGTGG - Intronic
941865160 2:170326814-170326836 CCTGTGGGAATGACTTGCAGAGG - Intronic
946307657 2:218865324-218865346 CCCGAGGGAGTGCCTGGCCTAGG - Intronic
946401207 2:219469252-219469274 CCTGGAGGTGGGACTGGCCAAGG + Exonic
947524641 2:230870685-230870707 CCTGGGGGAGGGGCTGGGCTCGG - Intronic
947731148 2:232432405-232432427 CCTGGGCGAGGGACTGACCTGGG + Intergenic
948803535 2:240443397-240443419 CCTGAGGCGGTGGCTGGCCGAGG + Intronic
948911118 2:241003131-241003153 GCTGGGGGAGTGCCTGAGCGGGG - Intronic
948916433 2:241036911-241036933 CCTGGGTGAGTGACTGGCCCAGG + Exonic
948975301 2:241460100-241460122 CCTGGGGGAGAGTCTGGTAGAGG - Intronic
1170549492 20:17464551-17464573 CGTGGGGCAGTGACTGGAAGGGG - Intronic
1172034206 20:32000306-32000328 GCTAGGGGAGAGACTGGCTGAGG - Exonic
1172628238 20:36360889-36360911 CATGGGGGTGTGACGGGCCAAGG + Intronic
1173482829 20:43416655-43416677 CCTAGGGGAGTGTCTGCCAGAGG - Intergenic
1173939929 20:46901949-46901971 CCTGGAGGAGTTAATGGCTGGGG + Intronic
1175130144 20:56782616-56782638 CCTGGAGGAGACACTGGGCGGGG - Intergenic
1175545365 20:59774572-59774594 CCTGGGGGAGGAACAGGTCGAGG + Intronic
1175922125 20:62455142-62455164 CCTGGGGGAGAGCCGGGCCACGG + Intergenic
1175954658 20:62603099-62603121 CTTGGAGGAGTGACCTGCCGTGG - Intergenic
1177313282 21:19424710-19424732 CCTGGGGGAAGGGCTGGCTGTGG + Intergenic
1178109746 21:29358051-29358073 CCTGCTGGAGTGACTGGAAGTGG + Intronic
1179466788 21:41581247-41581269 CCTGGGTGAGTCACTGGGCAGGG - Intergenic
1180206830 21:46265967-46265989 CATCGGGGAGAGCCTGGCCGCGG - Exonic
1181169469 22:21000172-21000194 GCTGAGGGGGAGACTGGCCGTGG + Exonic
1181515066 22:23405527-23405549 GCTGGGGGAGTGTCGGGCGGGGG - Intergenic
1182441894 22:30369582-30369604 CCTGGGGGAGTGGCTGCTGGTGG - Exonic
1182456398 22:30453745-30453767 CCTTGGGAAGTTAATGGCCGTGG + Intronic
1182521241 22:30885658-30885680 CCTGGGCCAGTCCCTGGCCGTGG - Intronic
1183025277 22:35060868-35060890 GCTGGGGGTGTGGCTGGACGGGG + Intergenic
1183473298 22:38021146-38021168 GCTGAGGGAGTGCCTGGCTGGGG + Intronic
1183976469 22:41515270-41515292 CCTGGGAGAGTGGCTGGACGTGG + Intronic
1184030326 22:41890493-41890515 CCTGGGGTTGGGACTGGCCCAGG + Intronic
1184348981 22:43930873-43930895 ACTGGGGGAGTACCAGGCCGAGG + Intronic
1185212976 22:49582237-49582259 CCTGGGGGTGTGTCTGCCTGGGG - Intronic
1185349602 22:50327507-50327529 CCTGGGGTCGTGTCTGACCGCGG + Intergenic
1185388844 22:50548386-50548408 CCTGGGGGAGGGTCTGGGCTGGG - Exonic
949877207 3:8634236-8634258 CCTGGGCCAGTGCCTGGCTGGGG - Intronic
950428747 3:12938890-12938912 CCTGGGGGAGGAACTGCCAGGGG - Intronic
950579362 3:13852487-13852509 CCTGGGGAACTGACTGGCACCGG + Intronic
951962828 3:28348583-28348605 TCTGGGTGAGTGACTCGCCAGGG - Exonic
953883294 3:46702365-46702387 CCTGGTGGAGAGCCTGGCTGGGG + Intronic
955142968 3:56287897-56287919 CCTTGGGAAGTGACTGGCACAGG + Intronic
957993202 3:87653467-87653489 CCTGGGGGAAGGAGTGGCTGTGG - Intergenic
958520865 3:95184349-95184371 CCTGGGGGAAAGAGTGGCTGTGG - Intergenic
962217658 3:133536612-133536634 CCTGGGGGAGTGGCTGGAGTAGG - Intergenic
962236073 3:133708527-133708549 CCAGGGAGAGTGACAGGCAGGGG + Intergenic
964131980 3:153299433-153299455 ACTGTGGGAGTGAGTGGCTGAGG + Intergenic
964300260 3:155278664-155278686 CCTGGAGGAATGCCTGGCCGTGG + Intergenic
966493777 3:180556836-180556858 CCTGGGGGAAGGGGTGGCCGTGG + Intergenic
966652316 3:182315249-182315271 CCTGGGGGCGGGGGTGGCCGTGG - Intergenic
967196395 3:187030026-187030048 ACTCTGGGAGTGAGTGGCCGTGG + Intronic
968534114 4:1113051-1113073 CATGGGGGGGTGAGAGGCCGCGG - Intronic
969437965 4:7199471-7199493 CCTGGTGGAGGGGCTGCCCGTGG + Intronic
973334143 4:48938732-48938754 CCTGGGGCAGGGACTGACCTGGG + Intergenic
974999756 4:69208142-69208164 CCTGGGGGAGTTACTACCCTTGG - Intronic
975014428 4:69396003-69396025 CCTGGGGTAGTTACTGCCCTTGG + Intronic
981047267 4:140276745-140276767 ACTGGGAGAGTGGCTGGCCGAGG - Intronic
982852904 4:160342070-160342092 CCTGGGGGAAGGGCTGGCTGTGG - Intergenic
983542924 4:168931604-168931626 CCTGGGGGTGTGTCTGCCAGAGG - Intronic
984526005 4:180860331-180860353 CCTGGGGGAAGGGTTGGCCGTGG - Intergenic
985565098 5:611774-611796 CCGTGGGGAGTGACTGGCTGGGG + Intergenic
985680541 5:1253586-1253608 CCTGAGTGAGTGTTTGGCCGAGG - Exonic
986303159 5:6494501-6494523 GCAGGTGGAGTGACTGGCCAGGG - Exonic
990210602 5:53479205-53479227 ACTGGGGGAGGGTCTGGCGGGGG + Intergenic
992395892 5:76369457-76369479 TGTGGGGGAGTGGCTGGGCGCGG + Intergenic
996912464 5:128670723-128670745 CCTGGAGGAATGCCTGGCCACGG + Intronic
997207733 5:132059865-132059887 GCTGGGGGAGGGGCTGGCCTGGG - Intergenic
1001553448 5:172620651-172620673 CCAGGGGGAGTGGCAGGCTGTGG - Intergenic
1002169578 5:177367567-177367589 ACTGGGCGAGGGACTGGGCGAGG + Intronic
1002640251 5:180627304-180627326 CCGGGGGGAGTGCCTGGCCTGGG + Intronic
1002692402 5:181059445-181059467 CCTGGGCGCCTGCCTGGCCGCGG + Exonic
1003312950 6:4985255-4985277 CCTGGGGAAGTGATGGGCTGGGG + Intergenic
1004811611 6:19269557-19269579 CCTGGGGGTGTGTCTGCCAGAGG - Intergenic
1006338581 6:33433515-33433537 CCCTGGGGAGTGACTGGGTGAGG - Intronic
1007416980 6:41696926-41696948 CTTGGGGGAGTGTCTGGGAGGGG + Intronic
1012408063 6:98923577-98923599 CCTGGGGAAGTGACTTACCTGGG - Intronic
1013304897 6:108838706-108838728 TCTGGGGAGGTGACTGGCGGTGG + Intergenic
1014818196 6:125957396-125957418 CCTAGGGGACTGACAGGCAGTGG + Intronic
1019340492 7:506767-506789 CCTGGGGGAGTGACTGGCCGGGG - Intronic
1019550305 7:1599124-1599146 CCCGGGGGCGTGACTGGGCCAGG + Intergenic
1019573770 7:1726455-1726477 CCTTGGGGAGGGACTTGGCGTGG - Intronic
1021133419 7:16938036-16938058 CCTGGGGCAGGGACTGGCAGGGG + Intergenic
1022058798 7:26770048-26770070 CCTGGGGGAATGGGTGGCTGTGG - Intronic
1023689646 7:42772828-42772850 CCTGTGGGAGGGGCTGTCCGAGG - Intergenic
1023817430 7:43961637-43961659 CCTGGGGCAGGGGCTGGCCAAGG - Intergenic
1024005861 7:45224581-45224603 CCAGGGGGAGTGGATGGCCATGG - Intergenic
1024261459 7:47576914-47576936 CCTCGGGAAGTGTCTGGCCAAGG - Intronic
1025261877 7:57425400-57425422 CCTGGGGGAGCTGCTGGCTGCGG + Intergenic
1026000564 7:66557087-66557109 CGTGGGGGAGTTGCTGGCTGCGG + Intergenic
1026538691 7:71261653-71261675 CCTGAGGTAGTGCCTGGCAGGGG + Intronic
1026994208 7:74605366-74605388 CCTGGGGGAGAGCCAGGCCTAGG + Intergenic
1028922396 7:96322223-96322245 CCTGGGGCAGTGGCTGGACAGGG + Intergenic
1029493794 7:100886431-100886453 CTTTGGGGAGTCACTGACCGTGG - Exonic
1029742055 7:102496511-102496533 CCTGGGGCAGGGGCTGGCCAAGG - Exonic
1029760044 7:102595676-102595698 CCTGGGGCAGGGGCTGGCCAAGG - Exonic
1033278058 7:139987456-139987478 CCTGGGGTGGGGACTGGACGTGG + Intronic
1033652512 7:143353496-143353518 CCTGGGTGGGGGACTGGCAGTGG + Exonic
1034338221 7:150337005-150337027 CCTGGGAGAGTGCCTGGGCCTGG + Exonic
1034421791 7:150994606-150994628 CCTGGTGGGGTGCCAGGCCGGGG + Intronic
1034629105 7:152516710-152516732 CCTGGGACAGTGACTGGCACAGG + Intergenic
1034989236 7:155537338-155537360 CCTGGTGGTGTCACTGGCCCTGG - Intergenic
1035019879 7:155794539-155794561 CCTGGGGATGTGACGGGCGGTGG + Intergenic
1035292994 7:157851579-157851601 CCCGAGGGAGGGACTGGCCAGGG + Intronic
1035366419 7:158351704-158351726 CGTGGGGCCGTGACTGGCTGTGG - Intronic
1035390823 7:158503471-158503493 CCTGGTGGGGAGACAGGCCGGGG - Intronic
1035998269 8:4573718-4573740 CCTGGGGGAAGGAGTGGCTGTGG - Intronic
1037841624 8:22249213-22249235 CCTGGGTGGGTGGCTGGCCAGGG - Exonic
1039454308 8:37697327-37697349 GCTGGGGGACTCACCGGCCGAGG + Exonic
1041881010 8:62750221-62750243 CCTAGGGGAGGGACTGACGGAGG + Intronic
1041881225 8:62751868-62751890 CCTGAGGGAGTGAGTGGGAGAGG - Intronic
1043532487 8:81166204-81166226 CCTGGGGGAAGGAGTGGCTGTGG + Intergenic
1043740717 8:83808165-83808187 CCTAGGAGAGTGCCTGGCCCAGG + Intergenic
1044219325 8:89650349-89650371 CCTGGGGGAGTATCTGCCTGGGG - Intergenic
1044252234 8:90017247-90017269 ACTGGGGGAGGTACTGGCCTTGG + Exonic
1045523929 8:102927528-102927550 CCTGGGAGAGTGGCTGGCTCTGG - Intronic
1048743895 8:137591958-137591980 CCTGGGGGAGGCACTGGGCTGGG + Intergenic
1049162188 8:141104727-141104749 CCTCAGGGAGTGCCTGGCGGTGG + Intergenic
1049203262 8:141351908-141351930 CCAGGGGGAGGGAATGGCAGGGG + Intergenic
1049349993 8:142159288-142159310 CCTTGGGCAGTGAGGGGCCGAGG + Intergenic
1049426464 8:142540083-142540105 CCTGAGGCAGTGACAGGCAGTGG + Intronic
1049497164 8:142941442-142941464 CCTGGGGCAGGGACAGGCCGGGG + Intergenic
1051852740 9:21528239-21528261 CCTGGGGAAGTGGCTGTGCGGGG + Intergenic
1052356534 9:27510792-27510814 CCTGGTGGAGAGACAGGCTGTGG - Intronic
1056056172 9:82826308-82826330 CCTGGTGGAGGGGCTGGCCCAGG - Intergenic
1056558026 9:87706203-87706225 CCTGGGGAAGTTGCTGTCCGTGG + Exonic
1056687133 9:88776076-88776098 ACTGGGGGAGTGAGTGCACGTGG + Intergenic
1057275477 9:93674018-93674040 CCTGTGAGCGAGACTGGCCGGGG + Intronic
1059451800 9:114375953-114375975 CCTGGGGTAGAGGCTGGCTGCGG - Intronic
1061403743 9:130382615-130382637 CCTGGGGGCGGGGGTGGCCGTGG - Intronic
1061762810 9:132862205-132862227 GCTGGGGGACTGACTTGCCGTGG + Intronic
1062013834 9:134281263-134281285 CTTGTGGGAGTGGCTGGCCAGGG + Intergenic
1062436941 9:136550573-136550595 GCTGGGGGAGTGAGTTGCCCGGG + Intergenic
1062609352 9:137367039-137367061 CCTGAGGGAGTCCCTGGCTGTGG + Intronic
1203792415 EBV:158979-159001 CCGGGGGCAGGGCCTGGCCGGGG + Intergenic
1186772427 X:12831025-12831047 CCCTGGGGAGTGTCTGGCCCCGG - Intergenic
1189285051 X:39846232-39846254 TCTTGGGGAGTGACTGGAGGGGG - Intergenic
1189971314 X:46420877-46420899 CATGGGGGAGTGGCTGCCTGAGG - Intergenic
1190834473 X:54087693-54087715 CCTGTGGGAGTGAATGGGCAGGG - Intronic
1191186729 X:57621032-57621054 CCTGGGGGAATGGGTGGCTGTGG + Intergenic
1192992163 X:76471780-76471802 CTTGGGGGAATGAATGGCTGTGG + Intergenic
1193571719 X:83152198-83152220 CCTGGGGGAAGGAGTGGCTGTGG + Intergenic
1198489989 X:137129980-137130002 CCTGGGGGAAGGAGTGGCTGTGG + Intergenic
1199469772 X:148181637-148181659 CCTGGGGGAAGGAGTGGCTGTGG - Intergenic
1200210275 X:154344047-154344069 CCTGGGGCTGACACTGGCCGGGG + Intergenic
1200220577 X:154388045-154388067 CCTGGGGCTGACACTGGCCGGGG - Intergenic