ID: 1019340494

View in Genome Browser
Species Human (GRCh38)
Location 7:506768-506790
Sequence CCCTGGGGGAGTGACTGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 311}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340494_1019340505 12 Left 1019340494 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340494_1019340506 13 Left 1019340494 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data
1019340494_1019340508 24 Left 1019340494 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1019340508 7:506815-506837 ATCCCAGCAGGGTCTGTGCCAGG No data
1019340494_1019340503 -1 Left 1019340494 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340494 Original CRISPR CCCTGGGGGAGTGACTGGCC GGG (reversed) Intronic
900209138 1:1444944-1444966 ACCTGGAGGAGTGACTGTGCAGG - Intergenic
900218975 1:1496862-1496884 ACCTGGAGGAGTGACTGTGCAGG - Intronic
900345403 1:2208124-2208146 GCCTGGGGGGGTGACTGCCAGGG + Intronic
900537938 1:3187990-3188012 ACCTTCGGGAGAGACTGGCCAGG + Intronic
900963317 1:5939733-5939755 CCCTGGTGTAGTCACTGGCATGG - Intronic
901653460 1:10756038-10756060 CCCTGGGGGAGGGTGTGTCCGGG - Intronic
902553630 1:17233908-17233930 GCCTGGGGCTGAGACTGGCCAGG + Intronic
902674736 1:18000906-18000928 GCTGGGGAGAGTGACTGGCCTGG + Intergenic
904268088 1:29329412-29329434 CCCAGGGAGAGAGATTGGCCAGG - Intergenic
904429144 1:30450834-30450856 CCCAGGGAGAGAGAGTGGCCAGG + Intergenic
904499045 1:30903583-30903605 CCCTGTGGGAGGGATTGGCCAGG - Intronic
904503128 1:30929188-30929210 CCCTGTGAGAGTGACAGGCCTGG + Intergenic
904629127 1:31828449-31828471 CTCTGGGGGAGTGGTTGGCAGGG + Intergenic
906240822 1:44241129-44241151 AACTGGGGGAGGGGCTGGCCTGG + Intronic
907407699 1:54263735-54263757 ACCTGTGGGGGTGAGTGGCCTGG - Intronic
909622524 1:77683607-77683629 CCCAGGGGCAGGGACTGGCCGGG - Intergenic
911126064 1:94342107-94342129 CCCTGGGGCAGTGCTTGGCATGG - Intergenic
911486680 1:98512835-98512857 CCCTGAGGGGGCGGCTGGCCGGG + Intergenic
912955506 1:114152474-114152496 GGCTGGGGGAGTGAGAGGCCTGG - Intronic
913688053 1:121252843-121252865 CCCTGGAGCAGTGACTGGTCAGG + Intronic
914039910 1:144040483-144040505 CCCTGGAGCAGTGACTGGTCAGG + Intergenic
914149549 1:145027437-145027459 CCCTGGAGCAGTGACTGGTCAGG - Intronic
915912433 1:159923279-159923301 ACCTGGGGGATGGACTGGCAGGG + Intronic
917476045 1:175369930-175369952 TCCTGGGAGAGAAACTGGCCTGG - Intronic
917527019 1:175797132-175797154 CCCTGGGGCATAGACTGGCCGGG - Intergenic
917736997 1:177930511-177930533 CTCAGGGGGAGGGGCTGGCCAGG - Intronic
920252444 1:204630684-204630706 TCCTGGGGAAGGGAATGGCCAGG - Intronic
920475375 1:206271342-206271364 CCCTGGAGCAGTGACTGGTCAGG + Intronic
922455764 1:225772219-225772241 CCCTGGTAGGGTGACAGGCCCGG + Intergenic
922798485 1:228353197-228353219 CCCTGGAGGAGGGGCTGGGCTGG + Intronic
1064060026 10:12129595-12129617 CCCTGGGGGCGGGGCTGGGCCGG + Intergenic
1067287458 10:44917088-44917110 CCCTGTGGGAGTGTATGGGCTGG + Intronic
1067467833 10:46514497-46514519 CCCTGGGCCAATGACTGGACTGG - Intergenic
1067851729 10:49759022-49759044 CCCTGGAGGACTGCCTGCCCTGG - Intronic
1070555841 10:77527287-77527309 CCCTGGGGAAGGGGGTGGCCTGG - Intronic
1072518300 10:96208297-96208319 CCCTGTGGGGGTTACTGTCCAGG + Intronic
1075321590 10:121495627-121495649 CCTTGGTGGTGTGACTGGCATGG + Intronic
1075728549 10:124623069-124623091 GCCTGGGGGAGAGCCTGGCCTGG - Exonic
1075733453 10:124649950-124649972 GCCTGGGCAAGTGACTGCCCTGG - Intronic
1076228720 10:128802348-128802370 CCCTGGGAGAGAGAGAGGCCAGG + Intergenic
1076311658 10:129512017-129512039 TCCTGGGTGTGTGGCTGGCCAGG + Intronic
1076482698 10:130795276-130795298 CCCTGGGGGAGGGCATTGCCAGG + Intergenic
1076699991 10:132266654-132266676 CCCTGGGGGAGGAACGAGCCAGG + Intronic
1077246670 11:1542610-1542632 TCCTGGGGGAGGAAGTGGCCTGG - Intergenic
1078654131 11:13222420-13222442 CTCTGGGGGAGAGCCAGGCCTGG - Intergenic
1080229254 11:30000400-30000422 TCCTTGGGGAGTGAATTGCCAGG - Intergenic
1080376893 11:31723341-31723363 ACCTGGGGGAGTGGGTGGCGGGG - Intronic
1080595999 11:33774606-33774628 CCCTGAGGGCGGGGCTGGCCCGG - Intergenic
1081644630 11:44781145-44781167 CACATGGGGAGAGACTGGCCAGG - Intronic
1083417281 11:62533915-62533937 CACTGTGGATGTGACTGGCCGGG - Exonic
1083728065 11:64638525-64638547 CCCTGGGGGAGTCCGTGGGCAGG - Intronic
1083849110 11:65355022-65355044 TCGAGGGGGAGTGACCGGCCAGG + Intronic
1083954933 11:65977971-65977993 CCCTGGGGCATTGCATGGCCCGG - Intronic
1084272055 11:68034246-68034268 CGCTGGGGGAGGGGCTGGCTGGG - Intronic
1084418604 11:69049120-69049142 ACCTGGGGAGGGGACTGGCCCGG + Intronic
1084547977 11:69823875-69823897 CCCAGGTGGAGGGACTGGCCTGG - Intergenic
1084554476 11:69867794-69867816 GCCAGTGGGAGTCACTGGCCCGG - Intergenic
1085729839 11:78987883-78987905 CCCTGTGTGGGTGAATGGCCTGG - Intronic
1088988478 11:114929778-114929800 CCCTGGGGAGGAGACTGCCCTGG + Intergenic
1089299404 11:117489595-117489617 CCCTGGGGGAGTGAAGACCCTGG + Intronic
1090264000 11:125342767-125342789 CTCTGGGGGAGGGGCGGGCCGGG + Intronic
1090960902 11:131555820-131555842 CCCTAGGGGAGTAGCTGCCCTGG - Intronic
1091669037 12:2439202-2439224 CCCTGGGCAGGTGGCTGGCCTGG + Intronic
1092849284 12:12612133-12612155 CCGGGAGGGAGTGCCTGGCCAGG + Exonic
1093038539 12:14354875-14354897 CCCTGACGGGGTGGCTGGCCGGG - Intergenic
1094781399 12:33795879-33795901 CCCTCTGTGAGTGACTGACCAGG + Intergenic
1096157363 12:49347941-49347963 CCCTGGGGAGGAGCCTGGCCTGG + Exonic
1096282217 12:50266009-50266031 TCCTCGGTCAGTGACTGGCCAGG + Intronic
1096621614 12:52869110-52869132 CCCTGGGGCAGTGACAGCACAGG - Intergenic
1098380962 12:69869166-69869188 CCCTTGGGGAGCTACTGGCAGGG - Intronic
1101330696 12:103755526-103755548 TGCTTGGGGAGTGACTGGCCAGG - Intronic
1101964777 12:109274888-109274910 CCCTTGGGGATGGCCTGGCCTGG + Intergenic
1104358715 12:128112142-128112164 CCCTGGGGCAGGCACTGCCCTGG - Intergenic
1104671723 12:130685535-130685557 CCCTGGAAGACTGAGTGGCCCGG + Intronic
1104674855 12:130705471-130705493 TCCTGGGGGAGAGGCTGGCAGGG + Intronic
1104846877 12:131851350-131851372 CCCTGGGGGAGGTGCTGGCGCGG + Exonic
1104861425 12:131926335-131926357 CCCTGACGGGGTGGCTGGCCTGG + Intergenic
1105976755 13:25480188-25480210 CCCGGACGGAGTGGCTGGCCGGG + Intronic
1106303973 13:28494564-28494586 GCCTCGAGGAGTGGCTGGCCTGG - Intronic
1109429383 13:62212360-62212382 CCCTGGCGGTGGGACTGCCCTGG - Intergenic
1111418139 13:87976210-87976232 CCCTGGTGGGGCGGCTGGCCGGG + Intergenic
1112548240 13:100392904-100392926 CCCTGGGTGAGTCACTTCCCTGG - Intronic
1113599979 13:111561628-111561650 CCCTGCAGGAGAGACTGGGCTGG - Intergenic
1116666200 14:47779077-47779099 ACCTGGGGGAGGGAGTGGGCAGG - Intergenic
1116973568 14:51093696-51093718 CCCTCGGGGAGGGACTGGGATGG - Intronic
1117922034 14:60734974-60734996 CCCTGGGGGAGAGACGCGCTGGG + Intronic
1118159445 14:63273997-63274019 CCCTGGGCGAGTGAGGGGCTCGG - Intronic
1122080241 14:99262178-99262200 GTGTGGGGGAGTCACTGGCCAGG - Intronic
1122635498 14:103127783-103127805 CCCTGGGGCAGAGCCTGGACAGG + Intronic
1122804777 14:104250735-104250757 CCCTGCGTGAGTGATTGGGCAGG + Intergenic
1122911031 14:104827651-104827673 CCCTGGGAGGCTGACTGGCTGGG + Intergenic
1122978673 14:105181465-105181487 GCCCGGGGGAAGGACTGGCCGGG + Intergenic
1202857225 14_GL000225v1_random:58933-58955 CCCTGTGGGAGAGCCTGGGCCGG + Intergenic
1123429661 15:20203936-20203958 CCCGGGCGGGGTGGCTGGCCGGG + Intergenic
1124580924 15:30954173-30954195 CCCTGGGGGAGGGCCTTGCAGGG - Intronic
1125527021 15:40383055-40383077 CCCGGGGCGAGGGACTGGGCTGG + Intronic
1126799848 15:52288898-52288920 CCTTGGGGGGGTGGCTGGCATGG - Intronic
1127402376 15:58602365-58602387 CTGTGGAGGAGTGACTGGCATGG - Intronic
1127952399 15:63822138-63822160 CCCTGGGAGTCTGCCTGGCCCGG + Intronic
1129169645 15:73799760-73799782 CCATGGGGAAGAGACTGGCCTGG - Intergenic
1129755885 15:78098678-78098700 GCCGGAGGGAGTGGCTGGCCTGG - Intronic
1131549131 15:93341677-93341699 CCCTTGGGGAGTGACACCCCAGG + Intergenic
1132178441 15:99733455-99733477 CCCTGGGGGCGGGACTGGGGAGG + Intronic
1132537815 16:492079-492101 CCCTGGGGCAGGGACAGGGCAGG - Intronic
1132854844 16:2040132-2040154 CCCTGGAGGAGTGGCTGCCTAGG - Exonic
1132889155 16:2195815-2195837 CGCTGGGGGTGTGGCTGCCCTGG - Intronic
1133125453 16:3643073-3643095 CCCTGGGGCACTGGCTGGGCGGG + Intronic
1133234153 16:4380103-4380125 CCCAGGGGCAGTGCCAGGCCTGG - Intronic
1133680454 16:8115317-8115339 CCCTGAGGGGGCGGCTGGCCGGG - Intergenic
1134657146 16:15955590-15955612 CCCTGAGGCAGGGACAGGCCTGG - Intronic
1134854235 16:17505839-17505861 CCCTGACGGGGTGGCTGGCCGGG + Intergenic
1134857836 16:17535539-17535561 CCCAGGGGAAATGATTGGCCAGG + Intergenic
1136664749 16:31800266-31800288 TCCTGGGGTAGTGACTGGGAAGG + Intergenic
1137039645 16:35599057-35599079 CTCTAGGCGAGTGACTGCCCAGG - Intergenic
1137696180 16:50463627-50463649 CCCAGGGGAAGGGACTGGCTTGG + Intergenic
1141683949 16:85559542-85559564 CCCTGGGGCAATGGCTGGACAGG - Intergenic
1141890618 16:86924428-86924450 CCCAGGGGAAGGGACTTGCCGGG - Intergenic
1142107718 16:88315277-88315299 CCCTGGGGCAGGGGCTGGCACGG + Intergenic
1142153587 16:88523371-88523393 CCCTTGCGGAGGGGCTGGCCGGG - Intronic
1142262578 16:89049781-89049803 CACAGGGGGAGGGGCTGGCCGGG + Intergenic
1143107489 17:4536879-4536901 CCCTGGGGGAGAGACGGGCGGGG - Exonic
1143947342 17:10604965-10604987 GACTGGGGGTGGGACTGGCCTGG - Intergenic
1144496696 17:15750105-15750127 CCCTGCGGCAGGGACCGGCCAGG - Intergenic
1144767369 17:17740022-17740044 CCCTGAGGGAATCACAGGCCAGG + Intronic
1144769787 17:17753088-17753110 CACTGGGTCAGTGTCTGGCCTGG + Intronic
1144904936 17:18634760-18634782 CCCTGCGGCAGGGACCGGCCAGG + Intergenic
1145043501 17:19594358-19594380 CTCTGGAGATGTGACTGGCCGGG - Intergenic
1146513780 17:33473181-33473203 CCCTGGGGCAGGGACTGGCATGG + Intronic
1146558710 17:33849588-33849610 CCCAGGGGGTGAGACTTGCCAGG + Intronic
1146653731 17:34623148-34623170 CCCTGGGGGAGGACCTGGTCTGG - Intronic
1147119609 17:38328260-38328282 CCCTGGGGGAGTGTGGGTCCAGG - Exonic
1148107097 17:45124530-45124552 CCCTGGGGCAGTGAGAGGACTGG + Intronic
1148404452 17:47398256-47398278 CCCGGGCGGGGTGGCTGGCCGGG - Intronic
1148406589 17:47421039-47421061 CCCGGGCGGGGTGGCTGGCCGGG - Intronic
1148959496 17:51381444-51381466 CCCAGGGGAAATGACTGCCCTGG - Intergenic
1149032810 17:52103331-52103353 GACTGGGAGAGTGACTGGCAGGG - Intronic
1149882561 17:60307785-60307807 CCTTGGGGGCGTGGCAGGCCAGG - Intronic
1150416404 17:64992342-64992364 CCCTTGGAGAGTGGGTGGCCAGG - Intergenic
1151876424 17:76870019-76870041 AGCTGGGGGAGTGACCGCCCCGG + Intronic
1152019891 17:77775521-77775543 CCCTAGGGAAGGGACTGTCCTGG - Intergenic
1152289144 17:79429001-79429023 CTCTGGGGGAGTCACTGGCAGGG - Intronic
1152538396 17:80963179-80963201 GCCTGAGGGAGGGACTTGCCTGG + Intronic
1152569460 17:81115346-81115368 CCCTGGGTGTGGGCCTGGCCTGG + Intronic
1152715949 17:81900751-81900773 CGCTGGGGGAGTGGCAGCCCCGG + Intronic
1153313775 18:3702491-3702513 CCCTAGGGGAGAGCCTGGCAGGG + Intronic
1153796117 18:8623851-8623873 CCCTGGGGCAGGGTGTGGCCAGG - Intronic
1153973666 18:10248084-10248106 ACCTCGGGGAGAGTCTGGCCAGG + Intergenic
1155218385 18:23662788-23662810 CCCCGGGAGAGTGAAGGGCCGGG - Exonic
1155317969 18:24591134-24591156 CCCCAGGGGAGAGATTGGCCCGG - Intergenic
1160511405 18:79455533-79455555 CCCTGGGGTGGTGGCTGGCACGG - Intronic
1161155049 19:2728136-2728158 CCCTAGGCCAGTGCCTGGCCAGG - Intronic
1161199161 19:3005042-3005064 CCATGGGGGAGCTACTGGCCAGG - Intronic
1161364029 19:3868334-3868356 ACCTGGGAGGGTGCCTGGCCGGG - Intronic
1161482626 19:4518455-4518477 CCCTGGAGGACGGACCGGCCCGG + Intergenic
1161660683 19:5544137-5544159 CCCTGGGGGAGAGGGAGGCCAGG - Intergenic
1161668290 19:5590194-5590216 CCTTGGGGACGTGCCTGGCCAGG + Intronic
1162717766 19:12644628-12644650 TCCTATGGTAGTGACTGGCCTGG - Intronic
1162916386 19:13876723-13876745 CCCTGGGCGGGGGAGTGGCCAGG - Intronic
1162940571 19:14006523-14006545 CCCTGCCGGAGTGACGGGCCCGG - Intronic
1163799510 19:19356123-19356145 CCCTGGGGCACTGCCTGCCCTGG - Exonic
1165335161 19:35164652-35164674 CACTGGGGGGCTGACTGGGCAGG - Intronic
1165903618 19:39180097-39180119 CTCTCGGGAAGTGAGTGGCCAGG + Intronic
1166197456 19:41216495-41216517 CCCAGGTGGAATGATTGGCCAGG + Intergenic
1167250046 19:48394703-48394725 CCTTGGGGGAGAGACAGGGCAGG + Intergenic
1167897462 19:52593428-52593450 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
1168246304 19:55114490-55114512 CCCAGGTGGAGAAACTGGCCGGG + Intronic
1168450187 19:56460388-56460410 ACCTGGGGGGATGAGTGGCCAGG + Intronic
924977940 2:195139-195161 TCCTGCAGGAGTTACTGGCCAGG + Intergenic
925780591 2:7378313-7378335 CCCAGGGGCAGTGACTGACCAGG + Intergenic
926062800 2:9814554-9814576 CCCTGGGGAAGGGAGAGGCCAGG - Intergenic
927207271 2:20618474-20618496 GCCTGGGTGACTGACTGGCCTGG - Exonic
927515635 2:23670236-23670258 CCCAGGAGGAGGGATTGGCCTGG + Intronic
927647524 2:24887433-24887455 CCCAGGTGCAGTGGCTGGCCTGG - Intronic
927945113 2:27130967-27130989 TGCTGGGGAAGGGACTGGCCTGG - Exonic
928108085 2:28485618-28485640 CCCTGGGGGAGTGACTGAAGTGG + Intronic
929949264 2:46393832-46393854 CCATGAGGGTGTGAGTGGCCAGG - Intergenic
933687811 2:85157481-85157503 GCCTGGGGCAGGGACTGGCTTGG + Intronic
934232920 2:90202279-90202301 CTCTGAGGAGGTGACTGGCCTGG + Intergenic
938109148 2:128552585-128552607 CCCTGGATGTGTGGCTGGCCTGG + Intergenic
940346614 2:152635703-152635725 CTGTGGGGGAGTGCCTGCCCCGG + Intronic
941106880 2:161364368-161364390 GCATGGGGGAGTGGCAGGCCAGG + Intronic
941603022 2:167563676-167563698 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
941603071 2:167563799-167563821 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
941794311 2:169583362-169583384 CCCTGGGCCACAGACTGGCCTGG - Intergenic
947711897 2:232321262-232321284 ACCTGGGCGAGGGACTGACCTGG + Intronic
947731146 2:232432404-232432426 GCCTGGGCGAGGGACTGACCTGG + Intergenic
948604755 2:239127825-239127847 TCCTGGGGGAGGGACAGGACAGG - Intronic
948632070 2:239308759-239308781 CCCTGGGGGAGTGAGGGCGCTGG - Intronic
1169227215 20:3864317-3864339 CCCTGGGGGTGGAACGGGCCAGG - Exonic
1170951796 20:20943293-20943315 GCCTGGGAGAGTGACTTACCTGG - Intergenic
1171055244 20:21900337-21900359 CCCAGGGTTAGAGACTGGCCTGG - Intergenic
1171207243 20:23290673-23290695 CCCTGGGAGAGTGACAGGAGGGG - Intergenic
1171899828 20:30846993-30847015 CCCGGGCGGGGTGGCTGGCCGGG + Intergenic
1171951917 20:31427766-31427788 CCCTGACGGAGCGGCTGGCCGGG - Intergenic
1172722857 20:37012806-37012828 CCCTGACGGGGTGGCTGGCCGGG - Intronic
1173162746 20:40664404-40664426 CTCTGGGGCAGGGACAGGCCAGG - Intergenic
1173939927 20:46901948-46901970 CCCTGGAGGAGTTAATGGCTGGG + Intronic
1174308767 20:49634220-49634242 AACTGTGGGAGTGATTGGCCAGG - Exonic
1175442692 20:59002475-59002497 CCCTGGGGGAGGGACAGGTGAGG - Intronic
1175946998 20:62563605-62563627 CCCTCTGGGAGTGACTGAGCTGG - Intronic
1175996922 20:62816218-62816240 CCCTAGGGCAGCGACTGCCCTGG + Intergenic
1176051350 20:63121061-63121083 CCCTGGGGAAGAGCCAGGCCAGG + Intergenic
1176170058 20:63692693-63692715 CCCTGGGACAGTGACTGCCGAGG - Intronic
1179466790 21:41581248-41581270 ACCTGGGTGAGTCACTGGGCAGG - Intergenic
1179906302 21:44424934-44424956 CTCTGGGTGAGTGGGTGGCCAGG + Exonic
1181618550 22:24071782-24071804 ACCAGGGGGAGAGACAGGCCTGG - Intronic
1181635401 22:24172099-24172121 CCCTGTGGGATCGACTGGGCGGG - Intronic
1181657737 22:24317055-24317077 CCCGGAGGGGGTGGCTGGCCGGG + Intronic
1181774121 22:25147537-25147559 CCCAGGGGGAGGGCATGGCCAGG - Intronic
1182614183 22:31575330-31575352 CCCAGGTGGAGAAACTGGCCAGG + Exonic
1183718235 22:39546827-39546849 TTCTGGGGGAGTGTCTGGCCTGG + Intergenic
1183845569 22:40537737-40537759 CCCGGACGGGGTGACTGGCCGGG - Intronic
1183992078 22:41604043-41604065 CCCTGGGGGAGTCCCTGTTCCGG - Exonic
1184377668 22:44124740-44124762 CCCTGAGGGAGTGACCCTCCAGG - Intronic
1184944001 22:47788152-47788174 CACTGGGGCAGGGACTGGCTGGG + Intergenic
1185081888 22:48714057-48714079 CCCTGGGCGAGGGCCTGGCACGG - Intronic
1185138907 22:49089433-49089455 CCCTGGGGGAGTCCGGGGCCTGG - Intergenic
1185388846 22:50548387-50548409 GCCTGGGGGAGGGTCTGGGCTGG - Exonic
949552474 3:5122596-5122618 CCCCGGGCGAGTGAGTGGGCGGG - Intronic
949877209 3:8634237-8634259 CCCTGGGCCAGTGCCTGGCTGGG - Intronic
950428749 3:12938891-12938913 CCCTGGGGGAGGAACTGCCAGGG - Intronic
951962829 3:28348584-28348606 TTCTGGGTGAGTGACTCGCCAGG - Exonic
953883292 3:46702364-46702386 CCCTGGTGGAGAGCCTGGCTGGG + Intronic
954356182 3:50084830-50084852 CCCGGAGGGAGCGGCTGGCCGGG + Intronic
956129367 3:66039289-66039311 CCCTCGGCCAGTGGCTGGCCAGG + Intergenic
956962209 3:74416155-74416177 CCCTGGGGGATTGTCTGGCTGGG - Intronic
961203346 3:125061664-125061686 CCCAGGTGGACAGACTGGCCTGG + Intergenic
961387446 3:126530413-126530435 CCCTGGGGCGGAGACAGGCCTGG + Intronic
961442338 3:126960495-126960517 CCCTCGGGGAGTCCCTGGCCTGG + Intergenic
961465560 3:127078887-127078909 CACAGGGCGAGCGACTGGCCAGG - Intergenic
961648074 3:128403266-128403288 CCCTGAGGCAGAGACAGGCCAGG + Intronic
962236071 3:133708526-133708548 CCCAGGGAGAGTGACAGGCAGGG + Intergenic
966985487 3:185175973-185175995 CCCGGGGGGAGTGAAGAGCCTGG - Intergenic
967942919 3:194780071-194780093 ACCTGGGGCAGTGACTGGAATGG + Intergenic
968309951 3:197675105-197675127 CCCGGCGGGAGGCACTGGCCAGG - Exonic
968641296 4:1716389-1716411 CCCTAGGGGAGTGGGTAGCCTGG + Exonic
968741602 4:2334289-2334311 ACCTAGGGGAGTGAGCGGCCTGG + Intronic
968972399 4:3802856-3802878 CCCTGGGGGAGGGGCTGGAGAGG + Intergenic
969292066 4:6246257-6246279 CCCGGAGGGAGAGACTGGTCTGG - Intergenic
969559016 4:7933993-7934015 CCCTAGCGGAGTGTCTGGCACGG + Intronic
969906751 4:10404235-10404257 CCCTGGGGGAAACACTGGCCTGG + Intergenic
972288425 4:37669329-37669351 CCCGGAGGGAGCGGCTGGCCAGG - Intronic
973334141 4:48938731-48938753 TCCTGGGGCAGGGACTGACCTGG + Intergenic
974949783 4:68573892-68573914 CCCTTGGGGGCTGACTGGCAGGG + Intronic
979246576 4:118513413-118513435 TCCTGGGGGAGTAAGGGGCCTGG + Intergenic
984845830 4:184107078-184107100 CCCTGGGGGAGGGAGTGGCAGGG + Intronic
985565096 5:611773-611795 GCCGTGGGGAGTGACTGGCTGGG + Intergenic
985707379 5:1409385-1409407 CCCTTGGAGAGGGAGTGGCCTGG + Intronic
985967280 5:3347365-3347387 CCCTGGGGGAGCCATTGTCCTGG + Intergenic
986303160 5:6494502-6494524 GGCAGGTGGAGTGACTGGCCAGG - Exonic
988448699 5:31317782-31317804 CACTGGGACAGTGACTGTCCGGG + Exonic
988502294 5:31793366-31793388 CCCTGGGGTAAAGACTTGCCTGG - Intronic
989557640 5:42816074-42816096 CCCTCGGGGGCTGACTGGCAGGG - Intronic
992382923 5:76256204-76256226 CCCTGGGGGAGTACCTTTCCAGG + Intronic
992801909 5:80301729-80301751 CCCTGACGGGGCGACTGGCCGGG - Intergenic
997207734 5:132059866-132059888 AGCTGGGGGAGGGGCTGGCCTGG - Intergenic
997457163 5:134025997-134026019 GCCTGGGGGAGGGAGTTGCCTGG + Intergenic
998052927 5:139051458-139051480 CCCTGTGGGACTGACTGTCGAGG - Intronic
998093245 5:139382966-139382988 TCCTTGGGGTGTCACTGGCCGGG + Intronic
998448659 5:142217727-142217749 CCCTTGGGGAGTGCCTGGCCTGG + Intergenic
999304695 5:150511965-150511987 TGCTGGGGGTGTGACTGGCTGGG + Intronic
999746358 5:154595564-154595586 CCTTGGTGGAGGGACAGGCCTGG - Intergenic
1000062909 5:157672109-157672131 GCCTGGGGGACTGACGGGCCAGG - Intronic
1002640249 5:180627303-180627325 CCCGGGGGGAGTGCCTGGCCTGG + Intronic
1003312948 6:4985254-4985276 CCCTGGGGAAGTGATGGGCTGGG + Intergenic
1004874534 6:19939938-19939960 CCCAGGCGGGGTGGCTGGCCGGG - Intergenic
1005063497 6:21797314-21797336 CCCGGAGGGAGCGGCTGGCCGGG + Intergenic
1005599501 6:27411997-27412019 TACTGGGGGCGTGACGGGCCAGG - Intergenic
1006369602 6:33635786-33635808 CCCTGGGGGATTGAGGAGCCTGG + Intronic
1007359428 6:41344378-41344400 CACTGTGGGGGTGACAGGCCTGG - Intronic
1007416979 6:41696925-41696947 CCTTGGGGGAGTGTCTGGGAGGG + Intronic
1008601561 6:53101184-53101206 CACTGGGGAAATGACTGGCCAGG - Intergenic
1011148631 6:84244807-84244829 CCCTGACGGGGTGGCTGGCCGGG + Intergenic
1012408065 6:98923578-98923600 CCCTGGGGAAGTGACTTACCTGG - Intronic
1012416329 6:99017765-99017787 CACTGCAGGAGTGACTGGACAGG + Intergenic
1014215448 6:118748626-118748648 CTCTGGGGTGGTGACTGGCTAGG + Intergenic
1014492805 6:122082743-122082765 CAATGGGGTAGTGACAGGCCAGG + Intergenic
1016916798 6:149251381-149251403 CCCAGTGGGAGTCACAGGCCGGG - Intronic
1018279801 6:162173010-162173032 CCCTGGGGAATTGAATGGCTTGG + Intronic
1018393044 6:163355268-163355290 CGCTGTTGGAGTGAGTGGCCAGG - Intergenic
1019257702 7:62352-62374 CCCTGGAGGAGTGAACAGCCTGG - Intergenic
1019297489 7:285865-285887 CCCGGCGGGAGTGACCGACCAGG + Intergenic
1019311638 7:364764-364786 CCCGGGGTGAGTGGCTTGCCTGG - Intergenic
1019318893 7:405950-405972 TCCAGGGGGAGGGCCTGGCCTGG + Intergenic
1019340494 7:506768-506790 CCCTGGGGGAGTGACTGGCCGGG - Intronic
1021133417 7:16938035-16938057 CCCTGGGGCAGGGACTGGCAGGG + Intergenic
1021242881 7:18226469-18226491 TCCAGGAGGAGTGACTGACCTGG - Intronic
1022504235 7:30900607-30900629 CCCTGGGGAAGTCACTGCTCTGG - Intergenic
1023042731 7:36186284-36186306 CCCTGGGGAAGTGACTGCAGAGG - Intronic
1025796036 7:64738914-64738936 CCCGGGCGGGGTGGCTGGCCCGG + Intergenic
1026538689 7:71261652-71261674 CCCTGAGGTAGTGCCTGGCAGGG + Intronic
1026962529 7:74417791-74417813 CCCTGGGAGAGAGGCCGGCCAGG + Intergenic
1028922394 7:96322222-96322244 TCCTGGGGCAGTGGCTGGACAGG + Intergenic
1028995285 7:97093299-97093321 CCCTGAGGCAGGGACAGGCCTGG - Intergenic
1029728753 7:102425709-102425731 CCCTGGTGAAGTCCCTGGCCCGG - Exonic
1030150481 7:106399489-106399511 CCTTGAGGGAGGGACTGGTCTGG + Intergenic
1030946511 7:115728619-115728641 GCCTGGAGGATTGACAGGCCTGG + Intergenic
1032410270 7:131689379-131689401 CCCTGGGGGACTGGGTGGACAGG + Intergenic
1035292992 7:157851578-157851600 TCCCGAGGGAGGGACTGGCCAGG + Intronic
1035637013 8:1155133-1155155 CCCTGGGGCAGCGGCTGGCCGGG + Intergenic
1036614990 8:10381124-10381146 CACTGGGGAAGTCACTGCCCAGG - Intronic
1036656345 8:10679736-10679758 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1036656361 8:10679792-10679814 CCCTGCAGGCGTGCCTGGCCCGG + Intronic
1037841626 8:22249214-22249236 TCCTGGGTGGGTGGCTGGCCAGG - Exonic
1038492644 8:27981749-27981771 CCCCGGGGGAGCCAGTGGCCAGG - Intronic
1039969012 8:42305916-42305938 CCCTGTGGTAGTCACAGGCCAGG - Intronic
1040121197 8:43687522-43687544 CCCAGGTGGGGTGGCTGGCCGGG + Intergenic
1041358258 8:57022521-57022543 CCCTGACGGAGTGGCTGGCCAGG - Intergenic
1041677215 8:60548661-60548683 CCCGGACGGAGTGGCTGGCCGGG + Intronic
1042929121 8:73996211-73996233 CCCAGGGGTTGGGACTGGCCTGG - Intronic
1044264445 8:90165763-90165785 CCCTGGGGGACCAACAGGCCAGG - Intergenic
1045325834 8:101117036-101117058 CCTTGGGAGAGTGAATGACCAGG + Intergenic
1048743893 8:137591957-137591979 GCCTGGGGGAGGCACTGGGCTGG + Intergenic
1048924664 8:139260838-139260860 CTCTGGAGGAGTAACTGGGCTGG - Intergenic
1049244759 8:141556354-141556376 CCCTGGGAGACTCAGTGGCCTGG - Intergenic
1049497162 8:142941441-142941463 TCCTGGGGCAGGGACAGGCCGGG + Intergenic
1049527207 8:143133415-143133437 CCCTGCGGCACTCACTGGCCTGG + Intergenic
1049637658 8:143697651-143697673 CCATGGGGGTGTGAGGGGCCGGG + Intronic
1050415845 9:5416730-5416752 CCCTGGAGAAGTGTCTGTCCTGG + Intronic
1050558261 9:6807910-6807932 CCCGGAGGGGGTGGCTGGCCGGG - Intronic
1051852738 9:21528238-21528260 CCCTGGGGAAGTGGCTGTGCGGG + Intergenic
1053097132 9:35338427-35338449 TCCTAGGGGAGTGACAAGCCTGG - Intronic
1057179059 9:93020086-93020108 GCCTGGTGGAGTCACAGGCCAGG + Intronic
1057307504 9:93920731-93920753 TGCAGGGGGAGTGTCTGGCCTGG - Intergenic
1057453931 9:95190606-95190628 CCCTGGGGGAGAGGCAGCCCAGG - Intronic
1058720616 9:107760512-107760534 TCCTGGGGGACTGGCTGGCCTGG + Intergenic
1059281194 9:113135715-113135737 GCCTGGGGTAGGGAATGGCCTGG + Intergenic
1060197605 9:121633669-121633691 CCCTGGGGCAATGTCTGTCCTGG - Intronic
1060508313 9:124214737-124214759 CCCTGGGGGAGGGCCTCCCCTGG + Intergenic
1061208086 9:129175946-129175968 CCCCGGGGGAGGGAGGGGCCGGG - Exonic
1061424946 9:130492967-130492989 CTCTGTGGGAGCAACTGGCCTGG - Intronic
1061494067 9:130961685-130961707 CCCTCGGCGAGTGTCTGGTCCGG + Intergenic
1061953025 9:133946862-133946884 CCCTGGGTGACAGGCTGGCCAGG + Intronic
1062013833 9:134281262-134281284 CCTTGTGGGAGTGGCTGGCCAGG + Intergenic
1062353379 9:136149950-136149972 CCCTGGAGGAGGGACAGGTCAGG - Intergenic
1062388580 9:136325039-136325061 CCCTGGGGGAGTGAGCTTCCCGG + Intergenic
1062436940 9:136550572-136550594 GGCTGGGGGAGTGAGTTGCCCGG + Intergenic
1062448960 9:136607564-136607586 CCGTGGGGGCGTCACTGTCCGGG - Intergenic
1062586506 9:137252165-137252187 CCCAGGGTGAGGGACAGGCCCGG - Intronic
1062656609 9:137606952-137606974 CCCGCGGTGCGTGACTGGCCTGG + Intronic
1203769000 EBV:39874-39896 CCCTGGGGGAGGGATCGGCGGGG - Intergenic
1187462594 X:19501191-19501213 CCCTGCTGGAGAGAGTGGCCAGG - Intronic
1188221792 X:27549775-27549797 CCCTGGGGGAATGAGTGCCTTGG - Intergenic
1189215066 X:39316071-39316093 CCCTGGGGGAGTTAATGGCATGG + Intergenic
1190834475 X:54087694-54087716 TCCTGTGGGAGTGAATGGGCAGG - Intronic
1197726602 X:129780924-129780946 CCCTGGGGCAGAGACCGGACTGG + Intronic
1199586542 X:149421164-149421186 CCCGGGCGGGGTGGCTGGCCAGG - Intergenic
1200217276 X:154373603-154373625 CCCAGTGGGAGGGTCTGGCCTGG - Intronic