ID: 1019340496

View in Genome Browser
Species Human (GRCh38)
Location 7:506769-506791
Sequence GCCCTGGGGGAGTGACTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340496_1019340508 23 Left 1019340496 7:506769-506791 CCGGCCAGTCACTCCCCCAGGGC 0: 1
1: 0
2: 4
3: 46
4: 361
Right 1019340508 7:506815-506837 ATCCCAGCAGGGTCTGTGCCAGG No data
1019340496_1019340505 11 Left 1019340496 7:506769-506791 CCGGCCAGTCACTCCCCCAGGGC 0: 1
1: 0
2: 4
3: 46
4: 361
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340496_1019340503 -2 Left 1019340496 7:506769-506791 CCGGCCAGTCACTCCCCCAGGGC 0: 1
1: 0
2: 4
3: 46
4: 361
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340496_1019340506 12 Left 1019340496 7:506769-506791 CCGGCCAGTCACTCCCCCAGGGC 0: 1
1: 0
2: 4
3: 46
4: 361
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340496 Original CRISPR GCCCTGGGGGAGTGACTGGC CGG (reversed) Intronic
900246803 1:1640138-1640160 CCACTGGGGCAGTGACGGGCGGG - Intronic
900258025 1:1707270-1707292 CCACTGGGGCAGTGACGGGCGGG - Intronic
900310757 1:2032177-2032199 GTCCTGGGGGTGGGACAGGCTGG + Intergenic
900345402 1:2208123-2208145 TGCCTGGGGGGGTGACTGCCAGG + Intronic
900538934 1:3193241-3193263 GCCCTGGAGGCGGGACGGGCAGG - Intronic
900550616 1:3252602-3252624 GCCCTGGGGGTGGGGCTGGTGGG + Intronic
900793488 1:4694062-4694084 GCCCTGGGGGTGTGCTGGGCAGG - Intronic
901653462 1:10756039-10756061 GCCCTGGGGGAGGGTGTGTCCGG - Intronic
901815184 1:11789730-11789752 GCCTGGGGGCAGTGACTGGCAGG - Exonic
901931756 1:12600504-12600526 GCCATGTGGGTGTGTCTGGCAGG + Intronic
902745850 1:18473847-18473869 GTCCTGGGGGAGTGCCAGCCAGG + Intergenic
903857578 1:26345891-26345913 GGCCTGGGCAGGTGACTGGCAGG + Exonic
904253551 1:29240649-29240671 AGCCTGGGGGAGGGGCTGGCAGG - Intronic
904334378 1:29787369-29787391 GCCCTGGGGAGGGGACTGGCAGG + Intergenic
904556144 1:31365925-31365947 GCCGTGGGTGAGTGTCTGGAAGG + Exonic
904598108 1:31659261-31659283 GGCCTGGGGGAGTTACTCCCTGG + Intronic
904629126 1:31828448-31828470 ACTCTGGGGGAGTGGTTGGCAGG + Intergenic
904869974 1:33610715-33610737 CCCGAGGGGAAGTGACTGGCTGG + Intronic
905058830 1:35121884-35121906 TCCCTGGCGGAGTGACTAGGGGG + Intergenic
906725563 1:48041723-48041745 CTCCTTGGGGAGTGACTGACAGG + Intergenic
906798544 1:48716537-48716559 GCCATAGGGGAGAGACTGGGAGG + Intronic
909622526 1:77683608-77683630 GCCCAGGGGCAGGGACTGGCCGG - Intergenic
910209064 1:84775360-84775382 GCCCTGAGGCACTGACTGGAAGG - Intergenic
910808026 1:91208002-91208024 GCCCTCGGGGGCTGACTCGCGGG + Intergenic
910808317 1:91210805-91210827 CCCCTAGGGGAGGGACTGGCAGG + Intergenic
910852908 1:91666125-91666147 GCCCTGGGGGGCTGACCTGCAGG + Intergenic
914887415 1:151596768-151596790 GCCCTGGCCCAGTGCCTGGCAGG + Intergenic
915530767 1:156500931-156500953 GCCCTGGGGAAGCGAGGGGCGGG - Intergenic
915686087 1:157636259-157636281 GCCAGGGGTGGGTGACTGGCAGG + Intergenic
915912432 1:159923278-159923300 AACCTGGGGGATGGACTGGCAGG + Intronic
916736501 1:167612027-167612049 GCCCTGGGGGAGTGAAAGGGAGG - Intergenic
916942844 1:169694371-169694393 GCACAGGAGGAGAGACTGGCTGG - Intronic
917527021 1:175797133-175797155 GCCCTGGGGCATAGACTGGCCGG - Intergenic
917652837 1:177095901-177095923 GCCATGGGGGAATGGCTGCCAGG + Intronic
920226424 1:204442510-204442532 GCCCAGGGTGAGTGACTGGTAGG - Exonic
922635046 1:227159841-227159863 GCTCTGGGGGAGTGAGGGGGTGG + Intronic
1064311017 10:14211926-14211948 GCACTGGGGAAGTGGCTGCCTGG + Intronic
1065138855 10:22701101-22701123 GCCCTGGGAGAGTTAGTGGTAGG - Intronic
1065810434 10:29438232-29438254 CCCCTAGGGGAGGGACCGGCGGG + Intergenic
1066352524 10:34649596-34649618 GCCCTGGGTGAGTGAGTGAGTGG + Intronic
1067085115 10:43234069-43234091 GCCCTGGGGAAGGGGCTGGAAGG + Intronic
1067616729 10:47762840-47762862 GGCCTGGGCCAGGGACTGGCTGG - Intergenic
1071041017 10:81309050-81309072 GCGCAGGGCGAGGGACTGGCAGG - Intergenic
1071433818 10:85627919-85627941 AAGGTGGGGGAGTGACTGGCAGG - Intronic
1073004450 10:100311979-100312001 GCCCAAGAGGAGTGACTGTCAGG - Intronic
1073254235 10:102140851-102140873 GCCCTGTGGGAGTCTCTGGAAGG - Exonic
1075427513 10:122353317-122353339 TCCCTGGTGGAGAGACAGGCAGG + Intergenic
1075616460 10:123893544-123893566 GTCCTGGGGGTTTGACAGGCAGG - Intronic
1075872248 10:125779461-125779483 GCCCTGAGGCTGGGACTGGCTGG + Intergenic
1076365035 10:129916188-129916210 AGCCTGGGGGAGAGACGGGCGGG + Intronic
1077118944 11:898007-898029 GCTCTGAGGGACTCACTGGCTGG - Intronic
1077195086 11:1275602-1275624 GCCGTGGGGGAGGGACATGCTGG - Exonic
1077375285 11:2202767-2202789 GGCCTGCCGGAGTGACTGCCTGG + Intergenic
1078084286 11:8224530-8224552 GCACTGGTAGAGTGGCTGGCTGG + Exonic
1079112300 11:17611608-17611630 GCCCTGGGGGGCTGATTGGATGG + Intronic
1079454787 11:20626870-20626892 GCCCTGGGGGAGTGGCCCTCTGG + Intronic
1080376894 11:31723342-31723364 GACCTGGGGGAGTGGGTGGCGGG - Intronic
1080606485 11:33869152-33869174 GCTCTGGGAGAGGGACTGGGCGG - Intronic
1081653470 11:44841055-44841077 GCCCTGGAGTATTGCCTGGCAGG + Intronic
1083431157 11:62614192-62614214 GGCCTGGGGGAGGGACTGAAGGG - Intronic
1083629763 11:64089486-64089508 GCCCTGGGGGAGTCAGGGGAGGG - Intronic
1084272056 11:68034247-68034269 CCGCTGGGGGAGGGGCTGGCTGG - Intronic
1084432877 11:69121489-69121511 GCCCTGGGGGAGCCACTCCCAGG - Intergenic
1084473632 11:69376855-69376877 ACCCTGGGGAACTGACAGGCGGG + Intergenic
1084476296 11:69391532-69391554 GCCCTGGGGAGATGCCTGGCGGG + Intergenic
1084491572 11:69481435-69481457 GCCCTGTTGGAGTGACTGCTGGG - Intergenic
1084831795 11:71775080-71775102 GCACTGGGCGCGGGACTGGCAGG + Intergenic
1085998799 11:81954274-81954296 GCCCTCGGGGACTGACCCGCAGG - Intergenic
1089452595 11:118608276-118608298 GGCCTTGGGGAGTGCCTGGGAGG - Intronic
1089611116 11:119669756-119669778 GCCCTGGGGAAGTGGCTTTCAGG - Intronic
1090288272 11:125519164-125519186 GCTAGGGAGGAGTGACTGGCTGG - Intergenic
1091766419 12:3122993-3123015 TCCCTGGGGGAGAGGCAGGCAGG + Intronic
1092848424 12:12605511-12605533 GCCCTGGGGAAAGGACTGGAAGG + Intergenic
1093863917 12:24201778-24201800 GCCCTTGGAGACTGACTGGATGG + Intergenic
1095511563 12:42956399-42956421 TCCCTGTGGGAGAGACTGGGTGG + Intergenic
1096621413 12:52867955-52867977 GCCCTAGGGTAGTGCCTGCCTGG - Intergenic
1098310190 12:69140703-69140725 GCCTTGTGGGAGTGTCTGGGGGG + Intergenic
1098380964 12:69869167-69869189 GCCCTTGGGGAGCTACTGGCAGG - Intronic
1099339897 12:81416676-81416698 GCCCTGTGGGAGTGATTGTGAGG - Intronic
1101029877 12:100648014-100648036 GCCCTGGTGGAATGCCTTGCCGG - Intergenic
1101805692 12:108061789-108061811 GTCCTGGGGGAGTGAATACCTGG + Intergenic
1102229625 12:111253389-111253411 GCCCTGGGGCAGGGGCTGTCTGG - Intronic
1103702031 12:122853238-122853260 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702045 12:122853269-122853291 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702059 12:122853300-122853322 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702073 12:122853331-122853353 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702087 12:122853362-122853384 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702101 12:122853393-122853415 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702115 12:122853424-122853446 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702129 12:122853455-122853477 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702143 12:122853486-122853508 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1103702157 12:122853517-122853539 GCCCTGGGGGTGTCAGGGGCAGG + Intronic
1104221335 12:126787493-126787515 GCCCTGGGGGAGCTCCTGGCTGG + Intergenic
1104674854 12:130705470-130705492 CTCCTGGGGGAGAGGCTGGCAGG + Intronic
1104850809 12:131872627-131872649 GGCCTGGTGGAGAGGCTGGCGGG + Intergenic
1106164788 13:27234286-27234308 GGCCTGGGGGGGTTAATGGCTGG - Intergenic
1107060927 13:36158979-36159001 GCCTTGGGGGAATGACAGGGTGG - Intergenic
1107440617 13:40424376-40424398 AACCTGGGGAAGTTACTGGCAGG - Intergenic
1108178265 13:47816842-47816864 GGCCTGGGAGGGTGCCTGGCTGG - Intergenic
1109343609 13:61090752-61090774 GCTCTGGAGGAGTGGCTGCCAGG - Intergenic
1110460943 13:75745131-75745153 GCCCTGGTGGGGTGAGTGGGAGG + Intronic
1111333635 13:86792613-86792635 GCGGTGGGGGCGGGACTGGCGGG + Intergenic
1113708125 13:112447063-112447085 GCTGTGGTGGAGTTACTGGCTGG - Intergenic
1114049864 14:18913917-18913939 GCCCTAGGGAGGTGACAGGCAGG - Intergenic
1114112693 14:19488013-19488035 GCCCTAGGGAGGTGACAGGCAGG + Intergenic
1114186108 14:20403703-20403725 GGGCTGGGGCAGTGACTGACTGG + Exonic
1117414359 14:55480002-55480024 GCACTTGAGGAGTGACTTGCTGG + Intergenic
1117922032 14:60734973-60734995 TCCCTGGGGGAGAGACGCGCTGG + Intronic
1118930369 14:70234869-70234891 GCCCAGGGAGGGTGACAGGCGGG - Intergenic
1119653083 14:76397332-76397354 GCCCTGGGGGACTGGCCTGCTGG - Intronic
1119808797 14:77499374-77499396 GCCCTGGGGGAGTTACTTCTAGG - Intergenic
1120833909 14:89023275-89023297 CCCCTGATGGAGGGACTGGCAGG + Intergenic
1120974886 14:90239802-90239824 GCCTTGTGGGAGTGTCTGGGGGG + Intergenic
1121226831 14:92327356-92327378 ACCCTGGGGGAGGGAATGACAGG - Intronic
1121232130 14:92365624-92365646 GCCCTGGGGAAAAGCCTGGCTGG - Intronic
1121494057 14:94379908-94379930 GCCCTGGGGATGTTACAGGCTGG - Intronic
1122299103 14:100722031-100722053 GGCCTGGGGGAGTGATACGCAGG + Intergenic
1122911029 14:104827650-104827672 TCCCTGGGAGGCTGACTGGCTGG + Intergenic
1123111060 14:105867010-105867032 GCGCTGGGGGAGTGGCTCTCTGG + Intergenic
1123919861 15:25062642-25062664 GGCCTAGGGGAGTGTGTGGCTGG + Intergenic
1124580926 15:30954174-30954196 TCCCTGGGGGAGGGCCTTGCAGG - Intronic
1124656281 15:31510395-31510417 CCCCTAGAGGAGCGACTGGCAGG + Intronic
1127290562 15:57566916-57566938 GCCCTGTGGCTGTGACTGCCTGG - Intergenic
1127298148 15:57627849-57627871 GGGCTGGGGGAGTGGGTGGCTGG + Intronic
1127984850 15:64061271-64061293 GCGCAGGGCGCGTGACTGGCAGG + Intronic
1128149822 15:65355849-65355871 GCTCTGGGGGAGGGGGTGGCGGG - Intronic
1129772867 15:78213746-78213768 GCCCTGGGGGACCCAGTGGCAGG - Intronic
1129790820 15:78339808-78339830 ACCCATGGGGAGTGAGTGGCAGG - Intergenic
1130885242 15:88087329-88087351 GCCCTGGGGGAGTGTCCGGCAGG + Intronic
1132415724 15:101617540-101617562 GCCCTCCTGGAGTTACTGGCTGG + Intergenic
1132810520 16:1794619-1794641 GCCCTGGGGGAGAGAGCGACTGG - Intronic
1132945920 16:2531481-2531503 GCCCAGCGGGAGTGAGTGGTGGG - Intergenic
1132959230 16:2612883-2612905 CCCCTGTGGGAGTGGCTCGCAGG + Intergenic
1132972290 16:2694858-2694880 CCCCTGTGGGAGTGGCTCGCAGG + Intronic
1138105177 16:54284201-54284223 GGCCAGGGGGACTGGCTGGCGGG - Intronic
1139507268 16:67405175-67405197 GCCCTGGGCTGGTGAGTGGCAGG - Intronic
1139861887 16:70028770-70028792 GGCCTGGGACAGTGGCTGGCTGG + Intergenic
1140227411 16:73089732-73089754 GCCCTGGGAGACTGACCTGCAGG + Intergenic
1141262156 16:82463778-82463800 GCCCTTGGAGAGGCACTGGCAGG + Intergenic
1141948527 16:87325833-87325855 GCCCAGGGGCAGTGACCTGCAGG - Intronic
1141950611 16:87336746-87336768 GCCCTCGGCCAGTGACTGGGTGG + Intronic
1142000713 16:87662692-87662714 GCCTTGGGGGCTTGACTGGCAGG + Intronic
1142126077 16:88411358-88411380 GTCCAGGGGGAGTGGCGGGCAGG + Intergenic
1142177510 16:88651817-88651839 GGCCTGGGGGAGGGGCAGGCTGG - Intergenic
1142262577 16:89049780-89049802 GCACAGGGGGAGGGGCTGGCCGG + Intergenic
1142471825 17:168973-168995 GCCCCGGGGGAGGCCCTGGCTGG + Intronic
1142785037 17:2214533-2214555 GCCCTGGGTGAGGGGCTGACTGG - Intronic
1143107491 17:4536880-4536902 ACCCTGGGGGAGAGACGGGCGGG - Exonic
1144912609 17:18695632-18695654 GACCTGGGGGGGTGTCTGCCTGG - Intergenic
1146275203 17:31512003-31512025 GCCCTGCCAGAGTGGCTGGCTGG + Intronic
1146441864 17:32904131-32904153 GCCTTGTGGGAGTGTCTGGGGGG - Intergenic
1147661059 17:42117356-42117378 GCCCTGGGGGAGGGGCTCTCTGG + Intronic
1147685275 17:42283448-42283470 GCCCTGGGGGAGAGGCTTGTAGG - Intergenic
1148740394 17:49889635-49889657 GCCCTGGGGGAGTCCCTGGTGGG + Intergenic
1149032811 17:52103332-52103354 CGACTGGGAGAGTGACTGGCAGG - Intronic
1151214661 17:72569367-72569389 GCCCAGGAGGAGGGGCTGGCGGG + Intergenic
1151540032 17:74760117-74760139 GGCCCGGGGGAGGGCCTGGCTGG + Intronic
1152289145 17:79429002-79429024 TCTCTGGGGGAGTCACTGGCAGG - Intronic
1152433450 17:80261486-80261508 GCCCTGGGGGAGTCCAGGGCGGG + Intronic
1152467598 17:80474876-80474898 GCCCTGGGTGATAGACTGGCTGG + Intronic
1152579560 17:81160043-81160065 CCCCAGGGGGAGTGAGGGGCAGG - Intronic
1152597457 17:81244776-81244798 GTCCTGGGGGAGTGACTGAAAGG - Intergenic
1152617957 17:81346360-81346382 GCCCAGGGGGCGTGGCTGGCGGG + Intergenic
1153313773 18:3702490-3702512 CCCCTAGGGGAGAGCCTGGCAGG + Intronic
1155218387 18:23662789-23662811 GCCCCGGGAGAGTGAAGGGCCGG - Exonic
1155784190 18:29876817-29876839 GCCCTTGGGGGCTGACTTGCAGG - Intergenic
1158089931 18:53699055-53699077 TCCCTGGTGCAGTGACAGGCAGG + Intergenic
1158632964 18:59132159-59132181 GCCCTGGGGCCATGAATGGCAGG + Intergenic
1160409146 18:78663141-78663163 GCCCTGGGGGAGGGCCGGGTGGG + Intergenic
1161088348 19:2345233-2345255 GCCCTGGGGGAGGCACAGGGCGG - Exonic
1161280046 19:3441156-3441178 GCCCTGCGGAGGTGCCTGGCAGG + Intronic
1161363964 19:3868084-3868106 GACCTGGGAGGGTGTCTGGCTGG - Intronic
1161364030 19:3868335-3868357 GACCTGGGAGGGTGCCTGGCCGG - Intronic
1161381328 19:3966606-3966628 GCCCTGGCAGAGTGAATGACGGG - Intronic
1161456216 19:4370875-4370897 ACCCTGGGGAAGTGTCCGGCAGG - Intronic
1161552778 19:4923363-4923385 GCCCTGGGCGAGGGGCTGCCTGG - Intronic
1161622807 19:5308190-5308212 GCCCTCCGGGCGTGGCTGGCAGG - Intronic
1162403667 19:10461199-10461221 GGCCTGGGGGCGGGGCTGGCTGG + Intronic
1162501118 19:11054452-11054474 TCCCTGGGGGAAGGACTGACAGG + Intronic
1162591932 19:11597658-11597680 GACCTGGGGGAGGGGCTGGTTGG + Intronic
1162725935 19:12689719-12689741 GCCCGGGGGGAGGGACAGTCAGG + Intronic
1162786855 19:13040452-13040474 GCCCTGCGGCAGGGATTGGCAGG + Intronic
1162794613 19:13080071-13080093 GCCCTGGGTGGGAGACTGGGTGG - Intronic
1163034625 19:14563676-14563698 GTCCAGGCGGAGGGACTGGCGGG - Exonic
1163404293 19:17112824-17112846 GGGCTGGGTGAGTGCCTGGCTGG - Intronic
1163554200 19:17983294-17983316 GCCCTGGAGGGGTCCCTGGCTGG + Intronic
1163867033 19:19782163-19782185 GCCCTCGGGGACTGACCTGCAGG + Intergenic
1165139045 19:33688257-33688279 GCCCTGTTGGCGTGACTGGCTGG + Intronic
1165161789 19:33820691-33820713 GGCCTGGGGAAGTGACTCACTGG - Intergenic
1165986333 19:39772076-39772098 GCCCTGGGTGAGAGACTGAAGGG - Intergenic
1166258196 19:41620494-41620516 GCCCCCAGGGGGTGACTGGCAGG + Intronic
1166305958 19:41937219-41937241 GCACTGGTGGGGTGGCTGGCTGG - Intergenic
1166786580 19:45370660-45370682 GCCCTAGCGGATTGACGGGCAGG - Intronic
1167502362 19:49855315-49855337 GCCCTGGGGGCGTGAGTGCAGGG + Intronic
1167659925 19:50790546-50790568 GCCCTGGGGGAGCTAAGGGCAGG - Intronic
1168611447 19:57804020-57804042 CCCCTAGGGGAGGGACCGGCAGG + Intronic
925026408 2:610615-610637 ACTCTGGAGGAGTCACTGGCTGG - Intergenic
926763882 2:16305368-16305390 AGCCTGGGGGAGTGTCAGGCAGG - Intergenic
927100153 2:19781902-19781924 ACCCTGGGAGAGTTACTAGCAGG - Intergenic
927207814 2:20621126-20621148 GCCCTGGGGCAGGGCCGGGCAGG + Intronic
929484149 2:42339764-42339786 GCCCTGTGGGAGTCCCTGACAGG - Intronic
929664230 2:43821500-43821522 GCACTGGGGAAGTGAGAGGCAGG - Intronic
932152630 2:69387096-69387118 GCCAGGGGCGAGTGGCTGGCGGG + Exonic
932620144 2:73260362-73260384 GCACTGGGGGAATGAGGGGCAGG - Intronic
933812916 2:86044334-86044356 GCCCTGGGGAGGTGATGGGCCGG - Intronic
936997804 2:118433782-118433804 GCATTGTGGGAGTCACTGGCTGG + Intergenic
937011993 2:118571244-118571266 GGCCTGGGGGAGTGTCTGGGAGG + Intergenic
937446607 2:121963493-121963515 GCCCTGGGTCAGTGGCTGGGGGG + Intergenic
937973724 2:127568394-127568416 GCCCTGGGGGAGGAAAGGGCAGG - Intronic
942456601 2:176142469-176142491 GCCCAGTGGGTGTGACTGACAGG - Intergenic
944100792 2:196023924-196023946 GAAATGGGGGAGTGACTGGTTGG + Intronic
944140034 2:196446179-196446201 GCCCTGTGGTAGAGAGTGGCTGG - Intronic
947624547 2:231611620-231611642 GCCCTGGGGCAGAGAGAGGCTGG + Intergenic
947843058 2:233221003-233221025 GCCCTGGGGGAGTGTTTGCCAGG - Intronic
948579296 2:238973183-238973205 GTCCAGGGGGAGGGAGTGGCAGG + Intergenic
948895839 2:240926468-240926490 GCCCTCAGGGACTGCCTGGCTGG - Intronic
1171207245 20:23290674-23290696 GCCCTGGGAGAGTGACAGGAGGG - Intergenic
1171310789 20:24143187-24143209 GCCGTGGGGGAGTGCCAGGGAGG - Intergenic
1172102289 20:32492411-32492433 GCCCAGGGGCAGTGACTAGAGGG + Intronic
1172444732 20:34987074-34987096 GTCCCGGGGCAGTGCCTGGCTGG + Intronic
1172764809 20:37345870-37345892 GCCCTGGCGGAGTGGGAGGCGGG + Intronic
1172919929 20:38472906-38472928 GCCCTGGGAGAGTCGCTGACGGG + Exonic
1173137999 20:40457410-40457432 GCTCTGGGGGAGTCCTTGGCTGG - Intergenic
1173939925 20:46901947-46901969 TCCCTGGAGGAGTTAATGGCTGG + Intronic
1174423323 20:50415194-50415216 GCCATGGGGGACTGCCAGGCAGG - Intergenic
1174680095 20:52398353-52398375 GCCCTTGGCCAGTGACTGGCTGG - Intergenic
1175730793 20:61352740-61352762 GACCGGGGGGAGTGAATGGCAGG - Intronic
1175907153 20:62386598-62386620 GGCCCGGGGGAGTGAGTAGCAGG + Intergenic
1177409257 21:20708583-20708605 GCCCTCGAGGAGTGTGTGGCTGG + Intergenic
1178707994 21:34890027-34890049 GCCCTGGGGGAGGGAGGAGCGGG - Intronic
1178836856 21:36105510-36105532 TCCCTAGGGGAGGGACCGGCAGG - Intergenic
1179886640 21:44316957-44316979 GCCCTGGGAGAGGGGCTGGGTGG + Intronic
1180008136 21:45032791-45032813 GACATGGGGGAGACACTGGCCGG - Intergenic
1180008157 21:45032882-45032904 GACATGGGGGAGACACTGGCCGG - Intergenic
1180022123 21:45134954-45134976 CTCCTGGGGCAGGGACTGGCAGG + Intronic
1180046501 21:45308723-45308745 TACCTGGGGCAGTGCCTGGCAGG + Intergenic
1180129068 21:45814254-45814276 GCTCTGGGTGAGTGAGTGGTGGG + Intronic
1180468346 22:15636293-15636315 GCCCTAGGGAGGTGACAGGCAGG - Intergenic
1180594353 22:16963664-16963686 GCCCTGGGGGAGAGACTGTGGGG - Intronic
1180600413 22:17011783-17011805 GCCTTGGGTGAGGGTCTGGCAGG + Intergenic
1181042989 22:20201623-20201645 GGGCTGGGGGAGAGAGTGGCAGG + Intergenic
1181052008 22:20242331-20242353 CCCCTGGGTGTGTGACTGCCGGG - Exonic
1181270043 22:21653283-21653305 ACCCTGGGGGAGGCACTGGCAGG + Intronic
1181460753 22:23084704-23084726 GCCTTGGGGTAGTGAAGGGCGGG - Intronic
1181533671 22:23531073-23531095 AGCCTGGGGGTGTGACTGCCCGG - Intergenic
1181809577 22:25395290-25395312 GCCCTGGGGGTCTGAGTGGAGGG + Intronic
1182246722 22:28964029-28964051 CACCTAGGGGAGTGACTGCCAGG + Intronic
1182270170 22:29148357-29148379 GCAGTGAGGGAGTGCCTGGCAGG + Intronic
1183012832 22:34961362-34961384 GCCCAGGGCGAGTGCCTGGTGGG + Intergenic
1183035081 22:35135145-35135167 GCCCTGGGGGAGGGGCAGGGTGG - Intergenic
1183069012 22:35383248-35383270 GCCCTGGTGGAGGGTGTGGCAGG + Intronic
1183332516 22:37229095-37229117 GTCCTGGGTGAGTGGGTGGCTGG - Intronic
1183469745 22:37999020-37999042 GCCCTGGGTGAGGGAATGACAGG - Intronic
1184243181 22:43222212-43222234 GCCCTTTGGGAGTGACCCGCTGG - Intronic
1184944000 22:47788151-47788173 CCACTGGGGCAGGGACTGGCTGG + Intergenic
1185213077 22:49582953-49582975 GTCCTGGAGGAGAGAGTGGCTGG - Intronic
949552476 3:5122597-5122619 GCCCCGGGCGAGTGAGTGGGCGG - Intronic
949877211 3:8634238-8634260 GCCCTGGGCCAGTGCCTGGCTGG - Intronic
950005170 3:9686859-9686881 CCCCTGGGCGAGGCACTGGCTGG + Intronic
950428751 3:12938892-12938914 CCCCTGGGGGAGGAACTGCCAGG - Intronic
950457935 3:13103646-13103668 GCACTGGGGGTCTGGCTGGCAGG + Intergenic
950492923 3:13317068-13317090 GCCCTGGGTGAGCGAGAGGCTGG - Exonic
950555759 3:13695052-13695074 GTCCTGGGGGAAGGCCTGGCTGG + Intergenic
953281761 3:41564866-41564888 GCCCTGAGGGAGTCAGTGACTGG - Intronic
953411647 3:42693582-42693604 GACCTGGGGCTGGGACTGGCTGG - Intronic
953702013 3:45203924-45203946 GACCTGGGGTAGTGACTGCAAGG + Intergenic
953883290 3:46702363-46702385 GCCCTGGTGGAGAGCCTGGCTGG + Intronic
954363025 3:50132525-50132547 GACCTCAGGGAGTGACAGGCTGG - Intergenic
954754206 3:52830392-52830414 CCCTTGGGGTAGTGCCTGGCGGG + Intronic
955354434 3:58218977-58218999 GAGATGGGGGAGTGACTGGTTGG - Intergenic
956735669 3:72236126-72236148 GGACTGGGTGACTGACTGGCTGG - Intergenic
956962211 3:74416156-74416178 ACCCTGGGGGATTGTCTGGCTGG - Intronic
960720704 3:120622393-120622415 CCCCTGGAGGAGGGACTGGCAGG + Intergenic
961298289 3:125904278-125904300 GCGCTGGGCGCGGGACTGGCAGG + Intergenic
961322565 3:126085806-126085828 GCCTTGTGGGAGTGTCTGGGGGG + Intronic
962236069 3:133708525-133708547 CCCCAGGGAGAGTGACAGGCAGG + Intergenic
962316693 3:134363817-134363839 GCCCTGGGGGAGGAAGGGGCCGG + Intronic
967980686 3:195063356-195063378 CTCCTTGGGGAGTGGCTGGCTGG + Intergenic
968083576 3:195863810-195863832 GCCCTGGGTGACAGACTGGGAGG - Exonic
968454943 4:692966-692988 GCCCTGGGGGAAGGACTGCCCGG + Intergenic
968522392 4:1039891-1039913 GCCCAGTGGGAGTGAGGGGCTGG + Intergenic
968749269 4:2378803-2378825 GCCCTGGGAGAATGAAAGGCTGG - Intronic
969289746 4:6231003-6231025 GCCCTGGGGCAGCCACTGGTGGG - Intergenic
969552659 4:7881317-7881339 GCCATGTGGGGGTGCCTGGCAGG - Intronic
969660234 4:8523173-8523195 TCCCTGGTGGGGTGACAGGCAGG + Intergenic
970092912 4:12430274-12430296 CCCGTAGGGGAGGGACTGGCAGG + Intergenic
970364202 4:15341965-15341987 GCCCTGGGGTGGGGCCTGGCGGG - Intronic
972681700 4:41312437-41312459 GCCCCAGAGGAGTGACTGGCCGG + Intergenic
972991176 4:44823786-44823808 GCCCTTGGGGGCTGACTTGCAGG + Intergenic
974949781 4:68573891-68573913 GCCCTTGGGGGCTGACTGGCAGG + Intronic
976765665 4:88594802-88594824 GACCGGGTGCAGTGACTGGCTGG + Intronic
978039193 4:104037722-104037744 AACCTGGGAGAGTGGCTGGCTGG - Intergenic
979052534 4:115953122-115953144 GCCCTCGGGGACTGACCTGCAGG - Intergenic
984845828 4:184107077-184107099 CCCCTGGGGGAGGGAGTGGCAGG + Intronic
985512980 5:322354-322376 GCCATGGGCGCGTGACAGGCAGG + Intronic
985565095 5:611772-611794 GGCCGTGGGGAGTGACTGGCTGG + Intergenic
986248192 5:6030176-6030198 GCCCTGGGAGAGTGAGAGACAGG + Intergenic
988448698 5:31317781-31317803 GCACTGGGACAGTGACTGTCCGG + Exonic
989557642 5:42816075-42816097 GCCCTCGGGGGCTGACTGGCAGG - Intronic
990210600 5:53479203-53479225 GGACTGGGGGAGGGTCTGGCGGG + Intergenic
990872183 5:60444293-60444315 GCCCTGGTGAAATCACTGGCAGG - Intronic
993822109 5:92631718-92631740 GCCCACGGCGAGGGACTGGCAGG + Intergenic
993899465 5:93574531-93574553 GCCCTGGGGGAGTGGGGGACAGG + Intergenic
994584003 5:101682559-101682581 GTCCTGGGTGAGTGGCTGCCCGG + Intergenic
997648134 5:135494668-135494690 GCCCTGGGCCAGCCACTGGCTGG + Intergenic
998094569 5:139389991-139390013 GCCCTGGAGGAGGGAGTGGGAGG - Intronic
998506754 5:142678581-142678603 GCACTGGGGGAGAGAATGGGTGG - Intronic
999304694 5:150511964-150511986 GTGCTGGGGGTGTGACTGGCTGG + Intronic
999999121 5:157120619-157120641 GGCCTGGGGGCTTGACTGCCAGG - Intronic
1001810854 5:174627132-174627154 GCCATAAGGGAGTGACAGGCTGG - Intergenic
1002103323 5:176868110-176868132 GCCCTGGGGGCGGGAGGGGCAGG - Exonic
1002596914 5:180329750-180329772 GCCCTGGGGGAGCTACTGGGTGG + Intronic
1003312946 6:4985253-4985275 CCCCTGGGGAAGTGATGGGCTGG + Intergenic
1004200336 6:13541927-13541949 GCGCAGGGCGAGGGACTGGCAGG + Intergenic
1005063495 6:21797313-21797335 GCCCGGAGGGAGCGGCTGGCCGG + Intergenic
1006063895 6:31447024-31447046 GCCCTGGGTGAGTGAGTGAGTGG + Intergenic
1006719245 6:36139396-36139418 GTCCTTGGGCAGTGTCTGGCCGG - Exonic
1007245881 6:40462278-40462300 GCCCTGGGATAGTGGCTGGTAGG + Intronic
1007416977 6:41696924-41696946 CCCTTGGGGGAGTGTCTGGGAGG + Intronic
1008123523 6:47644494-47644516 GCCCTCGGGGACTGACCTGCAGG - Intergenic
1008717528 6:54307147-54307169 TCCATGGGGGAGTGGCTGGTAGG + Intergenic
1011416264 6:87122813-87122835 GCCCTGGCGGAGGGACTGGCGGG - Intergenic
1011570119 6:88725797-88725819 CCCCTAGGGGAGGGACTGGCTGG - Intronic
1011922409 6:92596068-92596090 GACCTGGGGGAGAGGCAGGCTGG + Intergenic
1015597543 6:134880144-134880166 GCCCAGGTGGTATGACTGGCAGG + Intergenic
1016829253 6:148417241-148417263 GCCCTGGAGCACTGACTGGGAGG + Intronic
1018082378 6:160269750-160269772 GACATGGGGGAGTGCCTGGAGGG + Intronic
1019261525 7:84507-84529 GCCCTGAGGTACTGACGGGCAGG + Intergenic
1019328540 7:451703-451725 GCCCTGGGGGAGGGACAGTTGGG + Intergenic
1019340496 7:506769-506791 GCCCTGGGGGAGTGACTGGCCGG - Intronic
1019477873 7:1252712-1252734 GCCCTGGGGGAGGGGGTGGGAGG - Intergenic
1020125612 7:5531093-5531115 GGCAAGGGGGAGTGACTGCCTGG - Intronic
1020220787 7:6235045-6235067 GCTCTTGGGGAGTGAGTGGTGGG - Intronic
1020347777 7:7183209-7183231 GCCCGGGAGGAGGGACTGGGAGG - Intronic
1020388125 7:7630269-7630291 GCACTGGGGGAGTGGGTGGATGG + Intergenic
1021133415 7:16938034-16938056 GCCCTGGGGCAGGGACTGGCAGG + Intergenic
1021147638 7:17108222-17108244 GCCCTGTAGGAGTGTCTGGGAGG + Intergenic
1021849529 7:24794386-24794408 CCCCTAGGGGAGAGACCGGCGGG + Intergenic
1024177860 7:46860131-46860153 GCTGTGGGTGGGTGACTGGCAGG - Intergenic
1025247664 7:57329181-57329203 GCCATGGGGGACTGCCAGGCAGG + Intergenic
1026538687 7:71261651-71261673 TCCCTGAGGTAGTGCCTGGCAGG + Intronic
1028793511 7:94878987-94879009 CCCCTCGGGGAGGGACTGGCGGG - Intergenic
1029710170 7:102295063-102295085 GCCCTGGGGGAGGCTCTCGCAGG - Intronic
1030310888 7:108068137-108068159 GCCCTGGGGGTGACACTTGCAGG + Exonic
1031973686 7:128080937-128080959 GCCCTGGGCGAGTGACTGTGGGG - Intronic
1032054362 7:128672639-128672661 GCCCTGGGGGAGGGGGGGGCGGG + Intronic
1032067573 7:128783186-128783208 GTCCTGGCGGGGTAACTGGCAGG + Intergenic
1033529369 7:142247152-142247174 GCCATGGGGGAGGGCCAGGCTGG + Intergenic
1034140164 7:148808117-148808139 CACCTGGGGGAGCAACTGGCGGG - Intronic
1034349566 7:150407360-150407382 GCCCTTGGGAAGGGACTGGAAGG + Intronic
1034437624 7:151070658-151070680 ACCCTGGGCGAGGGACTGGAAGG + Intronic
1034711777 7:153198919-153198941 TCCCTGGGGGAAGGACTGTCTGG + Intergenic
1034946784 7:155267365-155267387 GCCCTGTAGGAGGGACTGGGAGG + Intergenic
1035481805 7:159192802-159192824 CCCCTGGGGGATTGCCTGGCAGG - Intergenic
1035637011 8:1155132-1155154 TCCCTGGGGCAGCGGCTGGCCGG + Intergenic
1035695788 8:1594857-1594879 GCCCAGGGGGCATGGCTGGCAGG - Intronic
1038328474 8:26589868-26589890 GCACTGGGGGAATGACTGCTGGG - Intronic
1039473491 8:37827539-37827561 GGCCTGGAGGAGTGAGCGGCAGG - Intronic
1039485188 8:37904433-37904455 GCTCTGGGGGAGTGACTGTCAGG - Intergenic
1041376109 8:57210443-57210465 GCCCTGCCGGTGTGGCTGGCAGG + Intergenic
1042490586 8:69393316-69393338 GCCCTGGGGGTTTGACTAGCAGG - Intergenic
1044219328 8:89650351-89650373 GGCCTGGGGGAGTATCTGCCTGG - Intergenic
1044722880 8:95167833-95167855 GCCCTGCGGGTGTGACAGGAGGG + Intergenic
1047509489 8:125505635-125505657 GCCCTGGGGCAGAACCTGGCAGG - Intergenic
1048387718 8:133928072-133928094 CCCCTGGGCGAGAGATTGGCAGG + Intergenic
1049335076 8:142079955-142079977 GCAAGGGGGGCGTGACTGGCAGG + Intergenic
1049409215 8:142464976-142464998 GCCACAGGTGAGTGACTGGCGGG + Exonic
1049726775 8:144150204-144150226 GGCCTGGGATGGTGACTGGCGGG + Intronic
1049955465 9:688893-688915 CCCCTGGGGGTATGGCTGGCTGG + Intronic
1050035523 9:1432012-1432034 GCCCTGGAGGACTGAGTGTCTGG - Intergenic
1050090543 9:2014347-2014369 ACCCTGGGGGCGGGGCTGGCGGG - Intergenic
1051852736 9:21528237-21528259 GCCCTGGGGAAGTGGCTGTGCGG + Intergenic
1052338037 9:27339083-27339105 GCCTAGGGGGAGTGCATGGCAGG - Intronic
1052987961 9:34501838-34501860 GCCTTGGGTGGGTAACTGGCAGG - Intronic
1053451438 9:38197344-38197366 GCTCTGTGGGGGTGACAGGCAGG + Intergenic
1053617349 9:39781672-39781694 GCCCTGGGGACTTGAATGGCAGG + Intergenic
1053875527 9:42541035-42541057 GCCCTGGGGCCTTGAATGGCAGG + Intergenic
1053897118 9:42753598-42753620 GCCCTGGGGCCTTGAATGGCAGG - Intergenic
1054236172 9:62560689-62560711 GCCCTGGGGCCTTGAATGGCAGG - Intergenic
1054266817 9:62925765-62925787 GCCCTGGGGACTTGAATGGCAGG - Intergenic
1054550310 9:66595219-66595241 GCCCTGGGGACTTGAATGGCAGG - Intergenic
1055651440 9:78410381-78410403 GCGCAGGGCGAGGGACTGGCAGG + Intergenic
1056806532 9:89733235-89733257 ACCCTGGGGCAGAGACTGTCAGG + Intergenic
1057520059 9:95752764-95752786 GTCCTGGGTGAGGGACTTGCTGG - Intergenic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1059451896 9:114376199-114376221 GCCCTGGGGTAGAGCCTGGTGGG - Intronic
1059635087 9:116162438-116162460 GGCCTGGGGCAGTGACCTGCAGG + Intronic
1060035629 9:120253138-120253160 GCCATGGGGGAGAGACTCACTGG + Intergenic
1060484278 9:124037302-124037324 TCCCTGGGGCAGCGGCTGGCAGG - Intergenic
1060524405 9:124312350-124312372 CCCCTGGGGGGGTGCCTGGGAGG + Intronic
1060995367 9:127872659-127872681 GCCCTGGTGGGGTGAGAGGCAGG - Intronic
1061207733 9:129174370-129174392 GCTCTGGGGGCGTGAGTCGCGGG - Intergenic
1061208088 9:129175947-129175969 GCCCCGGGGGAGGGAGGGGCCGG - Exonic
1061348108 9:130042936-130042958 GCTCTGGGTGAGTGAGGGGCTGG - Exonic
1061625546 9:131838880-131838902 GCCTCGAGGGAGTGAGTGGCTGG + Intergenic
1061876627 9:133547292-133547314 GCCCTGGGGGCGTCACGGGCTGG - Intronic
1062448962 9:136607565-136607587 GCCGTGGGGGCGTCACTGTCCGG - Intergenic
1062501488 9:136853844-136853866 GCCCTGGGGCCCTGGCTGGCAGG + Exonic
1203769002 EBV:39875-39897 GCCCTGGGGGAGGGATCGGCGGG - Intergenic
1187521847 X:20021091-20021113 ACCCTGGGGAAGGCACTGGCAGG - Intronic
1190735138 X:53250901-53250923 GCACTGGTGGAGGAACTGGCGGG + Exonic
1195546873 X:106122982-106123004 GCCTTGTGGGAGTGTCTGGGGGG - Intergenic
1195846754 X:109237455-109237477 GCCCTCGGGGGCTGACTTGCAGG + Intergenic
1198742217 X:139853188-139853210 CCCCTAGGGGAGGGACTGGCGGG - Intronic
1199637506 X:149827151-149827173 TCCCTAGGGGAGGGACTGGCAGG - Intergenic
1200145303 X:153923305-153923327 GCCCCTGGGAAGTCACTGGCGGG - Intronic
1200157621 X:153985613-153985635 GCCCAGGGGGATTGGCTGTCAGG + Intergenic
1200226563 X:154420814-154420836 GCCCTGGGAGGGTGACGGGATGG - Intronic
1202271427 Y:23078314-23078336 GCGCACGGTGAGTGACTGGCGGG - Intergenic
1202294599 Y:23342368-23342390 GCGCACGGTGAGTGACTGGCGGG + Intergenic
1202424422 Y:24712058-24712080 GCGCACGGTGAGTGACTGGCGGG - Intergenic
1202446367 Y:24958027-24958049 GCGCACGGTGAGTGACTGGCGGG + Intergenic