ID: 1019340497

View in Genome Browser
Species Human (GRCh38)
Location 7:506773-506795
Sequence GGCAGCCCTGGGGGAGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 398}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340497_1019340508 19 Left 1019340497 7:506773-506795 CCAGTCACTCCCCCAGGGCTGCC 0: 1
1: 0
2: 1
3: 43
4: 398
Right 1019340508 7:506815-506837 ATCCCAGCAGGGTCTGTGCCAGG No data
1019340497_1019340503 -6 Left 1019340497 7:506773-506795 CCAGTCACTCCCCCAGGGCTGCC 0: 1
1: 0
2: 1
3: 43
4: 398
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340497_1019340505 7 Left 1019340497 7:506773-506795 CCAGTCACTCCCCCAGGGCTGCC 0: 1
1: 0
2: 1
3: 43
4: 398
Right 1019340505 7:506803-506825 CACATCCTGGTGATCCCAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 159
1019340497_1019340506 8 Left 1019340497 7:506773-506795 CCAGTCACTCCCCCAGGGCTGCC 0: 1
1: 0
2: 1
3: 43
4: 398
Right 1019340506 7:506804-506826 ACATCCTGGTGATCCCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340497 Original CRISPR GGCAGCCCTGGGGGAGTGAC TGG (reversed) Intronic
900127605 1:1075456-1075478 GGCAGCCCTGGGGGAGCCTCTGG - Intergenic
900161840 1:1227591-1227613 GGCTGGCCTGGGGGACTCACGGG + Intronic
900538935 1:3193245-3193267 GTCAGCCCTGGAGGCGGGACGGG - Intronic
900793489 1:4694066-4694088 AGCAGCCCTGGGGGTGTGCTGGG - Intronic
900855573 1:5179609-5179631 GTCAGCCCTAGGGGACTCACTGG - Intergenic
901045441 1:6393193-6393215 GGCAGGCCTGGGGCGGTGACCGG + Intronic
901736621 1:11316580-11316602 GGCAGCCCTGGGGAACAGAAAGG - Intergenic
901829854 1:11885783-11885805 GACAGCCCTGTGGGTGAGACCGG + Intergenic
901923238 1:12550563-12550585 GGCGGCCCTGGGTCAGGGACGGG - Intergenic
901923850 1:12553657-12553679 GGCTGCCCTGGGGCAGGGACAGG - Intergenic
902386166 1:16077078-16077100 GGCAGCCCTGGGGGTGGGGCGGG + Intergenic
902620267 1:17646743-17646765 GCCAGCCCTGGGGAGGTGAGGGG + Intronic
902716424 1:18275933-18275955 GGCAACACTGGGGCAGAGACCGG - Intronic
902717049 1:18280089-18280111 GGCAGCCCGGGGGGTGACACGGG + Intronic
902878219 1:19353556-19353578 GGCAGCCCTGGGAGGGTCAGAGG - Intronic
902936946 1:19771439-19771461 GGCAGGCCTGGTGCAGTGGCTGG - Exonic
903212358 1:21825484-21825506 GGCAGGCTTGGGCGAGTGACTGG + Intronic
903226043 1:21894683-21894705 GGCAGCCCCCGGGGAGGGGCTGG + Intronic
903551424 1:24159602-24159624 GGCTGGCCATGGGGAGTGACTGG + Exonic
903884637 1:26533926-26533948 GGCAGCCCTGGAGAACAGACTGG - Intronic
904492492 1:30869738-30869760 GGAAGGCCTGGGGGAGGGAATGG + Intronic
904809519 1:33154277-33154299 GGCTGTCCTGGGTCAGTGACTGG - Intronic
904873015 1:33633625-33633647 GGCAGCCCTGGGGAAGTTGTTGG + Intronic
905016608 1:34782332-34782354 GGCAGCCATGGGAGTGTGTCAGG + Intronic
905106324 1:35565614-35565636 GGCAGCCATGCGGTAGTGGCTGG - Exonic
905824365 1:41017534-41017556 GGCAGTGCTGGGGCAGGGACGGG - Intronic
906145684 1:43558750-43558772 GGGAGCCCTGGGGGAGGGGAGGG + Intronic
906510734 1:46409244-46409266 GGCAGACCTGGGGGAGCAGCAGG + Intronic
907554038 1:55329224-55329246 GGCAGGCCTGGGGCTGTGAGAGG - Intergenic
907763516 1:57386019-57386041 TGCAGCTTTGGGTGAGTGACTGG + Intronic
909598230 1:77430992-77431014 TCCAGCCCTGGTGGAGAGACTGG + Intronic
911583504 1:99662765-99662787 TGCACCCCCGGGGGAATGACTGG - Intronic
912680366 1:111725408-111725430 GGCAGTCCTGGGGGGGGGCCTGG + Exonic
913246944 1:116878542-116878564 AGGAGCGCTGGGGGAGGGACAGG + Intergenic
914918506 1:151832459-151832481 GGCAGGCCTGGAGGAGTGCCTGG + Intergenic
915285203 1:154847923-154847945 GTCGGAGCTGGGGGAGTGACTGG - Intronic
915313622 1:155016596-155016618 GGGGGCCCTGGGGTAGAGACCGG - Exonic
915530770 1:156500935-156500957 GCCAGCCCTGGGGAAGCGAGGGG - Intergenic
916736503 1:167612031-167612053 CAAAGCCCTGGGGGAGTGAAAGG - Intergenic
917749652 1:178042210-178042232 GGCAGTCCTGGAGGAATGCCTGG - Intergenic
920965244 1:210695917-210695939 GGCAGCTCTGGCAGACTGACAGG + Intronic
922573130 1:226645413-226645435 GGCAGCCCTGGGGCAGGAAGCGG + Intronic
922635044 1:227159837-227159859 GGTGGCTCTGGGGGAGTGAGGGG + Intronic
923107005 1:230862139-230862161 GGCATCTCTGAGGGAGTGATGGG - Intronic
1064138482 10:12770756-12770778 GCCAGCCATGTGGGAGTTACAGG + Intronic
1066702334 10:38143290-38143312 GGAAGGCCTGGGGGACTCACTGG + Intergenic
1066990051 10:42504739-42504761 GGCAGCCCTAAGGCAGTCACAGG + Intergenic
1066990140 10:42505414-42505436 GGAAGGCCTGGGGGACTCACTGG - Intergenic
1067696176 10:48537188-48537210 GGCAGCCCTTGCGGGGTGGCTGG + Intronic
1069898882 10:71695768-71695790 GGCAGCCCAGGGACAGTGGCAGG + Intronic
1069920597 10:71813228-71813250 GCGAGCCCTGGGGGAGGGAAAGG - Exonic
1070758863 10:79010806-79010828 GGCAGCGTGGGGTGAGTGACAGG - Intergenic
1071548997 10:86551643-86551665 GGCATCCATGTGGGAGAGACAGG - Intergenic
1071797067 10:89018826-89018848 GCCGGCCCTGGGGCAGTGAGGGG - Intergenic
1073254237 10:102140855-102140877 GCCAGCCCTGTGGGAGTCTCTGG - Exonic
1073301877 10:102475810-102475832 AGCAGCCCTGGCGGAGCGTCGGG - Exonic
1075198683 10:120383094-120383116 GGCAGCACTGGGAGAATGAAAGG + Intergenic
1075301592 10:121329408-121329430 TCCAGCCCTTGGGGAGTGATGGG - Intergenic
1075486881 10:122829626-122829648 GGACACCCTGGGGGAGTGGCTGG + Intergenic
1075662920 10:124210543-124210565 GGAAGCCCTGGAGGAATGAAAGG - Intergenic
1075933782 10:126322568-126322590 TCCAGCCCTGGGGCAGTGATAGG + Intronic
1076091611 10:127691450-127691472 GGCAGAACTGGGGGACTGTCTGG - Intergenic
1076445166 10:130509410-130509432 GGCAGCTCTGGGAGTCTGACAGG + Intergenic
1076505590 10:130970845-130970867 GGGAGCCCTGGGGGACTGGAGGG + Intergenic
1076603013 10:131671162-131671184 GGCACCCATGGGGGAGGGAAGGG + Intergenic
1076922444 10:133461328-133461350 GGCAACCCTGGGGGAGAGGCTGG + Intergenic
1077050144 11:562884-562906 GTCAGGGGTGGGGGAGTGACAGG - Intronic
1077050170 11:562970-562992 GTCAGGGGTGGGGGAGTGACAGG - Intronic
1077162747 11:1121145-1121167 GGCAGCCCTGGGGCGGTGGGAGG + Intergenic
1077266888 11:1655316-1655338 GTCAGCCCTGGGGGAGGCCCAGG - Intergenic
1077309155 11:1880850-1880872 GGCAGCCCTTGGGGAGCCCCAGG + Intronic
1077477451 11:2797152-2797174 GGCAGACCTGGGGGGGTGGCGGG + Intronic
1077887415 11:6395935-6395957 GGCAGTGCTGGGAGAGTGTCGGG - Exonic
1078511171 11:11985253-11985275 GGCAACCCTGGTGGTGTGGCCGG - Intronic
1078518810 11:12047339-12047361 GGCAGCCCTGGGGAAGAGGCAGG - Intergenic
1082792432 11:57355736-57355758 TGCAGGCCTGGGGGAATGAAGGG - Intronic
1082879173 11:58021580-58021602 GTCACCCCTGGGAGAGTTACAGG + Intergenic
1083315563 11:61813032-61813054 GGCAGCCTTGGGGGAGCCATAGG + Intronic
1083720560 11:64601670-64601692 GGCAGCCCTGGGGGAGAGTGGGG - Exonic
1084020316 11:66413420-66413442 GGCAGGCCTGGGGGATGGCCTGG + Intergenic
1084033735 11:66495533-66495555 GCCAGCCCTGGGGGCGTGGAGGG + Intronic
1086362329 11:86071598-86071620 GGTAGCGATGGGGGAGTTACTGG - Intergenic
1086382872 11:86275957-86275979 GGCAGCCCTGTGGGGTTCACAGG - Intronic
1087058512 11:93956501-93956523 AGCAGTCCTGGGGGAGTGGCTGG - Intergenic
1087399828 11:97651525-97651547 GGGACCCATGGGAGAGTGACTGG + Intergenic
1088151444 11:106750120-106750142 GACAGCCCTGGGGAAGCCACTGG + Intronic
1089173665 11:116533521-116533543 GGCAGCCCTGAGGGAATGGAAGG - Intergenic
1089366613 11:117924630-117924652 GGGAGCCCTGGGGTTGTGGCAGG + Intronic
1089656257 11:119948931-119948953 GGCAGTCCATGGGGAGAGACTGG + Intergenic
1091234841 11:134014418-134014440 GGCAACCCTGGGAGAGAGGCAGG + Intergenic
1091280105 11:134376831-134376853 GGCTGCCCAGGGGGAGTGCAGGG + Intronic
1091290620 11:134437438-134437460 GCCAGGCCTGGAGGTGTGACCGG - Intergenic
1092592756 12:9966546-9966568 GGCAGGCCTGGAGGAATGCCTGG + Intronic
1098343614 12:69476734-69476756 GGCGGCTGTGGGGGAGGGACGGG + Intronic
1100616414 12:96234933-96234955 GGCAGCCAGGGAGGAGAGACAGG + Intronic
1101815947 12:108146347-108146369 TGAACCCCTGGGGGAATGACAGG - Intronic
1101867140 12:108528589-108528611 GGCAGGCATGGGGCAGTGACAGG + Intronic
1102116796 12:110409134-110409156 GGCAGTCCTGGAGGAATGCCTGG + Intergenic
1102227030 12:111235994-111236016 GGCAGACCTGGGGCCGTGCCAGG - Intronic
1102768146 12:115451150-115451172 GGCAACCCTCGGGGAAAGACAGG + Intergenic
1102937575 12:116910880-116910902 GGCAGCGCCGGGGGCGTGGCGGG + Intergenic
1103967978 12:124652257-124652279 CCCAGACCTGGGGGAGAGACTGG + Intergenic
1104373869 12:128247351-128247373 CGCTGCCCTGGGGCAGTGAGGGG + Intergenic
1104679236 12:130737785-130737807 GCCTGCCCTTGGGGAGGGACTGG + Intergenic
1104788440 12:131466761-131466783 GGCAGGCATGGGAGGGTGACTGG - Intergenic
1104984248 12:132587657-132587679 GGCAGCCCAGAGGGACTGCCTGG - Intergenic
1105537927 13:21287479-21287501 GGAATCCCTGGAGGAGTCACAGG - Intergenic
1105673623 13:22646338-22646360 AGCAGCCCTAGGGCAGTGACCGG + Intergenic
1105846965 13:24301668-24301690 GGCAGGCCAGGGGCAGGGACGGG + Intronic
1105965201 13:25377455-25377477 GGCAGCCACTGGGGTGTGACAGG - Intronic
1106576839 13:30982584-30982606 GGCAGTCTTGTGGGACTGACTGG - Intergenic
1108803876 13:54131170-54131192 GGCAGGCCTGGAGGAATGCCTGG + Intergenic
1110569772 13:76991463-76991485 GGCAGCACTCGGGTAGTGGCAGG + Exonic
1113931877 13:113972947-113972969 AGCAGCCCTGGGTGGGTTACGGG + Intergenic
1116490587 14:45498863-45498885 GGCAGGCCTGGAGGAATGCCTGG + Intergenic
1118159447 14:63274002-63274024 AGCAGCCCTGGGCGAGTGAGGGG - Intronic
1119693967 14:76698014-76698036 TGCAGACTTGGGGTAGTGACAGG - Intergenic
1120890272 14:89485212-89485234 GGCAGACCTGGGGGAGAGTGAGG + Intronic
1121193303 14:92048188-92048210 GGCAGTCCTGGAGGAATGCCTGG + Exonic
1121273293 14:92651890-92651912 GGCAGCACTGGGGGAGGGGGTGG - Exonic
1121391774 14:93582151-93582173 AGCAGCCCTGGAGGGGTGTCAGG - Intronic
1121595147 14:95156961-95156983 GGCAGCCCTGGGAGACTTTCCGG - Intronic
1122126151 14:99579711-99579733 GGCAGGCCTGGGGGAGTCCAGGG + Intronic
1122292719 14:100688229-100688251 GGCAGGCCTGGTGGAGAGGCTGG - Intergenic
1122415812 14:101549020-101549042 GGCAGCCTGGGGGAAGGGACTGG - Intergenic
1122784206 14:104156451-104156473 GGAAGCCCCGGAGGAGTGGCTGG + Intronic
1122804521 14:104249843-104249865 GGCTGCTCTGGGGGAGTGCTGGG + Intergenic
1124101536 15:26698728-26698750 GGGAGCCTTTGGGGAGCGACAGG - Intronic
1124148992 15:27159995-27160017 GGCAGCCCTGTGGGAATGGGAGG - Intronic
1124843133 15:33263462-33263484 GGCAGTGTTGGTGGAGTGACGGG - Intergenic
1125749363 15:42018469-42018491 TGCAGCCCTGGAGTAGGGACAGG + Intronic
1125884889 15:43221113-43221135 GGCAGCCCTGGGGGAGGGGGTGG + Exonic
1126582159 15:50251968-50251990 GGCAGCTCTGTGGTAGTGATGGG - Intronic
1127733436 15:61820516-61820538 GCCAGCCCTGGATAAGTGACAGG - Intergenic
1128546713 15:68573394-68573416 GGCAGAGCTGGAGGAGAGACAGG + Intergenic
1128635316 15:69298969-69298991 CGCAGCCCGGGAGGAGTGTCTGG + Exonic
1129246991 15:74285417-74285439 GGCAGCACAGGAGGAGAGACTGG - Intronic
1129253381 15:74320613-74320635 GGCCACCCTGGGGTGGTGACAGG + Intronic
1129672048 15:77612931-77612953 GGTAGGCCTGGGGGGGTGTCAGG - Intergenic
1129690664 15:77711518-77711540 GGCAGCCCTGGGGCAAAGACAGG + Intronic
1130583057 15:85155653-85155675 GGCAGCCCTGGAGGAGGTCCAGG + Intergenic
1130885241 15:88087325-88087347 AGCGGCCCTGGGGGAGTGTCCGG + Intronic
1132178434 15:99733450-99733472 GGCCCCCCTGGGGGCGGGACTGG + Intronic
1132945922 16:2531485-2531507 GGGAGCCCAGCGGGAGTGAGTGG - Intergenic
1133317669 16:4894413-4894435 AGAAGCCCTGGGGGTGGGACTGG + Intronic
1136516780 16:30773255-30773277 GGCAGCCATGGGGTAGAGGCAGG + Intronic
1138352579 16:56353810-56353832 GGCAGCCCAGCAGGAGTGCCTGG - Intronic
1138597034 16:58034650-58034672 GGCACCCCTTGGGCAGTGATTGG - Intronic
1139063389 16:63283139-63283161 GGCTGCTCTGGGGGTGGGACTGG + Intergenic
1141410267 16:83828377-83828399 GACACACCTGGGGGAGTGAGGGG - Intergenic
1142045852 16:87924844-87924866 GGCAGCCATGTGGGAGTTTCTGG + Intronic
1142172577 16:88630629-88630651 GGCCTCCCTGGGGAAGCGACTGG - Intronic
1142245955 16:88970088-88970110 GGCAGGCCTGGGGGAGGGGTTGG + Intronic
1142496879 17:310642-310664 GGCAGCCCTGGGGGGCTGGAAGG - Intronic
1142687486 17:1586090-1586112 GACAGCCCTGGAGCAGGGACTGG + Intronic
1142688427 17:1591121-1591143 GGAAGGCCTGGGGGAGGGAAAGG - Intronic
1143544679 17:7589132-7589154 GGCAGCTATGGGTGAGTGCCTGG - Exonic
1143661481 17:8327104-8327126 GGCAGCCCCGCGGGAGGGGCGGG - Intergenic
1144309298 17:13997890-13997912 GACACACCTGGGTGAGTGACAGG + Intergenic
1144960299 17:19040810-19040832 GGCATCCCTGGGAGAGGGTCAGG - Intronic
1144974861 17:19133714-19133736 GGCATCCCTGGGAGAGGGTCAGG + Intronic
1145013808 17:19384291-19384313 GGATGCCCTGGGTGTGTGACAGG + Exonic
1145080667 17:19891938-19891960 GGCAGTCCTGGAGGAATGCCTGG + Intergenic
1145259119 17:21344163-21344185 CGCAGCCCTGTGGGAGTGGGAGG + Intergenic
1145317499 17:21743840-21743862 CGCAGCCCTGTGGGAGTGGGAGG - Intergenic
1145323012 17:21777513-21777535 AGCCATCCTGGGGGAGTGACTGG - Intergenic
1146160092 17:30555031-30555053 GGCTGCCCAGGGTGGGTGACCGG - Intergenic
1146180825 17:30697277-30697299 CCCAGCCCTGGGGAAGTGACAGG - Intergenic
1146258281 17:31404374-31404396 CCCTGCCCTGGGGAAGTGACTGG + Intronic
1146513778 17:33473176-33473198 GGAGGCCCTGGGGCAGGGACTGG + Intronic
1146924083 17:36732141-36732163 GGCTGCCCGGGGGCAGTGTCAGG + Intergenic
1147141812 17:38464666-38464688 GCCAGCTATGGGGCAGTGACAGG + Intronic
1147144983 17:38479568-38479590 GGCAGCCCTGGAGGTGGGCCAGG - Intronic
1147166457 17:38596123-38596145 TGGAGCCCTGGGTGAGGGACAGG + Intronic
1147310923 17:39595837-39595859 GGCAGCCCTGGTGGAGGGGCAGG + Intergenic
1147322713 17:39656028-39656050 GGCAGGCCTGGGGGCCTCACCGG + Intronic
1147605836 17:41773286-41773308 GGCGGCACTGGGGCAGTCACAGG - Intronic
1147746651 17:42698942-42698964 GGCAGGACTGGGGGAATGTCAGG - Exonic
1148064626 17:44859963-44859985 GGCAGCTCTGAGGGGTTGACTGG + Exonic
1148215315 17:45830864-45830886 GGCACACCTGGGGGAGAGATGGG - Exonic
1148327472 17:46791601-46791623 GCCTGGCCTGGTGGAGTGACAGG - Intronic
1148332495 17:46820752-46820774 GGGAGCCCTGTGGGTGGGACAGG - Intronic
1148444721 17:47730722-47730744 AGCAGCCATGGGGAAGTGAGGGG + Intergenic
1149537022 17:57441010-57441032 TGCAGCCCTGGGAGAGCGGCAGG - Intronic
1149847467 17:60016231-60016253 GGCCGCCCAGGGTGGGTGACCGG + Intergenic
1150085825 17:62272848-62272870 GGCCGCCCAGGGTGGGTGACCGG + Intronic
1150283123 17:63940805-63940827 GTCTGCCCTGGGGGAGGGGCGGG + Exonic
1150285913 17:63954053-63954075 CGGAGCCCTGGGGGAGTGAGAGG + Intronic
1151361985 17:73594383-73594405 AGCAGCACTGGGGGAGGGAAGGG - Intronic
1151362092 17:73595254-73595276 GGCAGGCCTGGGGGAGAGCGTGG + Intronic
1151657506 17:75502699-75502721 GGCGGGTCTGGGGGAGTGGCAGG + Exonic
1151685858 17:75646284-75646306 GGAAGCCCTGGGGCTGGGACTGG - Intronic
1151862015 17:76771196-76771218 GGCAACCCTTGGGGAGAGAGGGG - Intronic
1152062664 17:78090077-78090099 GGCAGCCCTGTGGCACTGATGGG + Intronic
1152097717 17:78281542-78281564 TGCAGCCCAGGGGAAGGGACTGG + Intergenic
1152248597 17:79199513-79199535 GGCAGCCCTAAGTCAGTGACTGG - Intronic
1152335504 17:79698303-79698325 GGCAGTTGTGGTGGAGTGACCGG + Intergenic
1152398277 17:80048579-80048601 GGCACCCCTGGGGGGATCACTGG - Exonic
1152789756 17:82272917-82272939 GGCGGGCCTGGGGGAGGGGCAGG - Intronic
1155242074 18:23873101-23873123 GGCAGCCCTGGGGCAGTGTCTGG + Intronic
1156849681 18:41711994-41712016 GGCTGCCCTGGGGTAGAGACTGG + Intergenic
1158210876 18:55048435-55048457 GTCTGCCCTGGAGGAGTGAAGGG + Intergenic
1158976620 18:62716126-62716148 GGCAGCGCCGGGGGAGTGCGAGG - Exonic
1159942608 18:74420075-74420097 GGCAGCCCCTGGAGGGTGACTGG - Intergenic
1160490803 18:79335563-79335585 GGGAGCCCTGCAGGAGTCACGGG - Intronic
1160521236 18:79509364-79509386 GGGGGACCTGGGGGAGTGGCTGG - Intronic
1160667918 19:341918-341940 GGCTGCCCTGGGGGAAGGGCTGG - Intronic
1160833098 19:1112373-1112395 GGCAGCGCTGGGGGCGGGGCCGG + Intronic
1160856569 19:1220544-1220566 TGCAGCCCTCAGGGAGTGCCCGG - Intronic
1161088350 19:2345237-2345259 AGCAGCCCTGGGGGAGGCACAGG - Exonic
1161163153 19:2771809-2771831 GGCAGCCCTTGGGGAGGCCCTGG + Intronic
1161287201 19:3474801-3474823 GGCATCTCTGGGGGACTGCCTGG + Exonic
1161377478 19:3947354-3947376 GAAAGCCCTGGGGGACTGGCGGG - Intergenic
1161412360 19:4123717-4123739 GGGAGCCCTCGGGGAAGGACGGG - Intronic
1161428491 19:4217404-4217426 GGCGGCCCTGGGGAAGTGCGAGG + Exonic
1161666210 19:5578616-5578638 GGAAGCCGTGGGGGAGGGAAGGG - Intergenic
1162033542 19:7927356-7927378 GGCAGCTCTGGGGGGGGGCCAGG + Intronic
1162303189 19:9855897-9855919 TGCAGCCCCTGGGGAGTCACTGG + Intronic
1162977753 19:14218258-14218280 CCCAGCCCTGGGGAAGTGACAGG + Intergenic
1163534678 19:17870314-17870336 CACAGCCCCGGGGGAGGGACAGG + Intergenic
1163762765 19:19146299-19146321 GGCAGCCCTCGAGGGGTGATGGG - Exonic
1165785460 19:38459160-38459182 TGCTGCCCTGGGGAAGTCACTGG - Exonic
1165795338 19:38516093-38516115 GCCAGCCCTCGGGGAGTGCCTGG + Exonic
1165971861 19:39638468-39638490 GGCAGCCTTGGGTGGGAGACAGG - Intergenic
1166862528 19:45818449-45818471 CCAAGCCCTGGGGGAGTGGCAGG + Intronic
1167148534 19:47696177-47696199 GGCAGCCCTGGGCGAGGGGACGG + Intronic
1167250043 19:48394698-48394720 CGCAACCTTGGGGGAGAGACAGG + Intergenic
1167694931 19:51009684-51009706 GGAAGCCCTGGGGCTGTGACAGG + Intergenic
1168107623 19:54174127-54174149 GGCAGCCCTGGGGCTGGGGCTGG - Exonic
1168642439 19:58039110-58039132 GGCTGCCCTGGGGCAGTAAGGGG - Intronic
925184873 2:1840278-1840300 GGCAGCCCAGCGGTAGTCACAGG + Intronic
925969520 2:9096710-9096732 AGCAGCCCGGGCTGAGTGACGGG - Intergenic
927871692 2:26628222-26628244 GGCTGCCCTGGGGGAAGGGCAGG + Intronic
928126519 2:28620399-28620421 TGCATCCCTGGAGGGGTGACAGG - Intronic
929564365 2:42975371-42975393 GGCAGGCGGGCGGGAGTGACTGG - Intergenic
929571221 2:43024328-43024350 AACAGCCCTGGGGGGGTGAGGGG + Intergenic
931647734 2:64440433-64440455 GGCAGCAATGGTGGAGTGAGAGG - Intergenic
931868152 2:66433532-66433554 GGCAGCCGTGGAGGAGTGCTCGG - Intronic
932791677 2:74659010-74659032 GGCAGCCCAGGGGGACTAACTGG - Intronic
933788727 2:85866313-85866335 GGCAGGCCCTGGGGATTGACTGG - Intronic
933812917 2:86044338-86044360 GGCTGCCCTGGGGAGGTGATGGG - Intronic
934635701 2:95987200-95987222 GGCGGTCCTGTGAGAGTGACAGG + Exonic
934679046 2:96269433-96269455 TGCAACCCTGGGGGAGTGCTTGG + Intronic
934797924 2:97118048-97118070 GGCGGTCCTGTGAGAGTGACAGG - Exonic
934835497 2:97585392-97585414 GGCAGTCCTGTGAGAGTGACAGG + Exonic
936057237 2:109270300-109270322 AGCAGCCCTGTTGGAGTGCCGGG + Intronic
937011991 2:118571240-118571262 GTCTGGCCTGGGGGAGTGTCTGG + Intergenic
940107345 2:150114845-150114867 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
943115567 2:183665512-183665534 GGCAGCTCTGGGTGAATTACAGG + Intergenic
943723893 2:191233151-191233173 TCCAGCCCTGGGGGAGTTAGTGG + Intergenic
944272984 2:197804543-197804565 GACAGCCCTTGGGGATTGGCAGG - Intergenic
944694014 2:202184774-202184796 GGAAGCCCTGGGAGAGTCAAGGG - Exonic
944770797 2:202912403-202912425 GGCAGGACTGGGGGAGTCAGAGG + Intronic
947526251 2:230878398-230878420 GGCAGCCCAAGGGGAAGGACCGG + Exonic
948110158 2:235448502-235448524 GACATCCCTGGGGGAGAGGCTGG - Intergenic
948344857 2:237287162-237287184 TTATGCCCTGGGGGAGTGACAGG - Intergenic
948612369 2:239178111-239178133 GCCAGCCCGGGGGAAGTGCCAGG + Intronic
1168756877 20:324548-324570 GCCAGTCCTGGGGGCGTGGCCGG - Intergenic
1170714093 20:18817263-18817285 GGCAGCCATGGGGCAGGGGCTGG + Intronic
1171207247 20:23290678-23290700 AGGGGCCCTGGGAGAGTGACAGG - Intergenic
1171310791 20:24143191-24143213 GTCTGCCGTGGGGGAGTGCCAGG - Intergenic
1173270031 20:41525394-41525416 GGCAGCTCTGGAGGAGGGATTGG - Intronic
1173455612 20:43198928-43198950 GGCAGCCCTGGAGTTGTGCCTGG - Intergenic
1173655419 20:44697138-44697160 GGCCTCCCTGGGAAAGTGACAGG - Intergenic
1173916137 20:46709829-46709851 GGCGGCCCTGGGGGAGCCAGGGG - Intronic
1174085652 20:48005695-48005717 GGAAGCCCAGTGGGAGTGCCGGG + Intergenic
1174139295 20:48401559-48401581 GCCAGAGATGGGGGAGTGACTGG + Intergenic
1174680096 20:52398357-52398379 GGAAGCCCTTGGCCAGTGACTGG - Intergenic
1175939431 20:62531270-62531292 GGCAGCTGTGGGGGAAGGACAGG - Intergenic
1176119787 20:63449078-63449100 GGCAGGCCTGGGGCACTGGCAGG + Intronic
1176172281 20:63701400-63701422 GGCTGCCCTGGGGGTGGGGCTGG + Intronic
1177840748 21:26231515-26231537 GGCAGGCCTGGAGGAATGCCTGG + Intergenic
1178280507 21:31278485-31278507 GGCAGCCCCAGGGGAATGTCTGG - Intronic
1178693906 21:34776312-34776334 GGTAGCAGAGGGGGAGTGACGGG - Intergenic
1179584836 21:42367935-42367957 GGCAGCCCTGGAGGAGGGGCTGG - Intergenic
1179633072 21:42690691-42690713 GGCAGCCGTGTGGGAGAGGCAGG - Intronic
1179829725 21:43989075-43989097 TGAACCCCTGGGGGAGGGACAGG + Intergenic
1180609641 22:17086759-17086781 GGCAGCCCTGTGGGGGTAGCAGG + Intronic
1180989959 22:19929735-19929757 GGCAGCCCTGGCAGACTAACGGG + Intronic
1181169223 22:20998864-20998886 GGCTGCCCTGTGGGTGTGGCAGG - Exonic
1181512855 22:23396511-23396533 GGCAGCGCTGAGGGAGTGTGAGG - Intergenic
1182125307 22:27811547-27811569 TGCAGCTCTGGTGGAGGGACTGG - Intergenic
1182294552 22:29305407-29305429 GGCAGCCCCAGGGCAGAGACAGG - Intergenic
1182435727 22:30328517-30328539 TGCAGACCTGTGGGAGAGACAGG + Intergenic
1183367073 22:37412559-37412581 GCCAGGCCTGGAGGAGTGCCAGG - Intronic
1183487662 22:38097997-38098019 GGCAGACCTCGGGGCGAGACCGG - Intronic
1184258672 22:43302000-43302022 AGCAGCTCTGGATGAGTGACAGG + Intronic
1184281437 22:43439873-43439895 GGCAGCTCTGGAGGGGTGAGTGG - Intronic
1184572561 22:45335270-45335292 GGCCACCCTGAGGCAGTGACTGG - Intronic
1184688668 22:46107731-46107753 GGCAGCCCTGGGGGTGAGCATGG - Intronic
1184714682 22:46274107-46274129 GGCTGAGCTGGGGGAGTGGCAGG + Intronic
1184847539 22:47098526-47098548 GGCTGCCCTGGGGAAGGGCCAGG + Intronic
1184847573 22:47098628-47098650 GGCTGCCCTGGGGAAGGGCCAGG + Intronic
1184889806 22:47372729-47372751 GGCAGCAGTGGGGCTGTGACAGG + Intergenic
1184973548 22:48044953-48044975 GGCAGCCTTGGGTGAGACACAGG + Intergenic
1185081891 22:48714062-48714084 GGCCGCCCTGGGCGAGGGCCTGG - Intronic
1185210243 22:49566660-49566682 TGGAGGCCTGGGGGAGTGGCTGG + Intronic
1185314791 22:50174335-50174357 GGCAGGACTGGGGGAGGGCCGGG + Intronic
1185396942 22:50597289-50597311 AGCAGCCCTGGGGGACTGGGAGG + Intronic
950198980 3:11029369-11029391 GGCAGTGCTGGGGGAGTGCCAGG - Intronic
950424707 3:12918938-12918960 GGCAGCCCAGGGGGAGTTTGAGG - Intronic
950523122 3:13508022-13508044 GGCTGCCCTGGAGGAGTTCCTGG - Intergenic
950531227 3:13553337-13553359 GGGAGACCTGTGAGAGTGACAGG + Intronic
950553300 3:13680571-13680593 GGCAGCCCTGGGGGTGCGAGTGG + Intergenic
950631197 3:14283351-14283373 GGGAGCCCTGGCTGAGTCACTGG + Intergenic
953982939 3:47421772-47421794 GCCAGCCCTGGGGGAAAGACGGG + Intronic
954147478 3:48641471-48641493 GCCAGCCCTGGGGGAGTGCGAGG - Exonic
954218489 3:49137898-49137920 GGGAGCCATGGGGGAGTCACAGG - Intergenic
955142966 3:56287891-56287913 GGCACTCCTTGGGAAGTGACTGG + Intronic
961648072 3:128403261-128403283 AGCAGCCCTGAGGCAGAGACAGG + Intronic
961723699 3:128912152-128912174 GTCAGCACTGGGGGGGTGTCTGG - Intronic
962269659 3:133968328-133968350 GGAAGCCCTGGAGGAATGAGAGG - Intronic
962676948 3:137764570-137764592 GGCAGCCCCGGGGGAGCGAGTGG - Exonic
963520444 3:146355782-146355804 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
964300258 3:155278658-155278680 GGCAGGCCTGGAGGAATGCCTGG + Intergenic
966279298 3:178209766-178209788 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
966397650 3:179519096-179519118 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
966860410 3:184228617-184228639 GAGAGCCCTGGGGAAGTGAGAGG - Intronic
968282542 3:197488033-197488055 GGCAGCATTGAGGGACTGACGGG + Intergenic
968482686 4:843370-843392 GGAAGCCTTGATGGAGTGACAGG - Intergenic
968494362 4:907256-907278 GGCAGAGCTGGGGGAGTGGGAGG - Intronic
968514088 4:1009286-1009308 GGCAGGACTGGGGGAGAGCCGGG - Intergenic
968522104 4:1038624-1038646 GGCAGGCCTGGGGGCTGGACAGG + Intergenic
968651284 4:1761244-1761266 GGCTGCCCAGGTGGAGTGCCGGG - Intergenic
968901131 4:3432473-3432495 TGCAGCCCTGGGGCTGTGGCTGG + Intronic
968904382 4:3444754-3444776 GGGTGCCCTGGGGCAGTGCCGGG + Intronic
969175246 4:5393797-5393819 CGCTGCCCTGGGTGAGTGATAGG - Intronic
969906749 4:10404230-10404252 AGCAGCCCTGGGGGAAACACTGG + Intergenic
970394674 4:15654754-15654776 AACAGGCCCGGGGGAGTGACGGG + Intronic
973334242 4:48939897-48939919 GGCATCACTGGGAGAGTGAATGG - Intergenic
978303234 4:107293900-107293922 GGCAGTCCTGGAGGAATGCCTGG + Intergenic
980289343 4:130825417-130825439 GGCAGCCCTGGGGGAAGCATAGG - Intergenic
982668069 4:158291134-158291156 GGCAGGGCTGGGGGAGGGAAAGG + Intergenic
984639055 4:182143635-182143657 GGCGGCCCTGGGGGAGGGGGCGG - Intergenic
985646545 5:1087464-1087486 GGCAGCCCTGGGGTTGCGCCCGG - Intronic
985843869 5:2329901-2329923 GGCAGCCCTGGGGCAGAGGGAGG - Intergenic
986608475 5:9545695-9545717 GGCGGCTCTGGGGAAGTGGCAGG - Exonic
987065071 5:14281734-14281756 GGCAGCCATGGTAGAGTGAGAGG + Intronic
988819074 5:34862882-34862904 GGGAGGCCTGGGGGAGTTAGAGG - Exonic
989399568 5:40994227-40994249 GAGGGCCCTGGGGGACTGACTGG + Intergenic
991360487 5:65814604-65814626 GGCAGCACTGAGGAGGTGACGGG - Intronic
991674072 5:69075025-69075047 GGCAGCCCTGTGGAGGTGCCCGG - Intergenic
992161455 5:74007900-74007922 GGCAACCTTGTGGAAGTGACTGG + Intergenic
994558185 5:101331197-101331219 AGCAGCCCTGGTGGTGTGACAGG - Intergenic
996727703 5:126687089-126687111 GGCAGCCCTAGGCCAGTGATGGG - Intergenic
997300201 5:132798092-132798114 GGGAACCCTGGGGGAGGGAAAGG + Intronic
997714421 5:136031237-136031259 GGCAGCCCTGTGGCATTAACAGG - Intronic
998444325 5:142186991-142187013 GGAAGGCCTGGGGGAGCGCCGGG - Intergenic
998805335 5:145912801-145912823 AGCTGCCCTTGGTGAGTGACTGG - Intergenic
999304638 5:150511720-150511742 GGCAGCACTGTGGGGGTGATGGG + Intronic
1000062910 5:157672114-157672136 GTCATGCCTGGGGGACTGACGGG - Intronic
1001453731 5:171845442-171845464 GGCATTTCTGGGGGAGTCACGGG - Intergenic
1001496042 5:172188269-172188291 GGCGGCCCTGGGGACCTGACAGG - Exonic
1002103324 5:176868114-176868136 GGCAGCCCTGGGGGCGGGAGGGG - Exonic
1002564433 5:180101836-180101858 ACCAGCCGTGGGGGAGTCACAGG + Intronic
1002596912 5:180329746-180329768 CACAGCCCTGGGGGAGCTACTGG + Intronic
1002695552 5:181086098-181086120 GACAGCCCTTGGGGCGGGACAGG - Intergenic
1002844395 6:934198-934220 GGCAGGCCTGGGGGAAGGATGGG + Intergenic
1004058062 6:12161223-12161245 GGCAGCTCTGCGGGAGGGGCCGG - Intronic
1005985421 6:30870745-30870767 GGCAGAGCTGGAGCAGTGACAGG + Intergenic
1006074530 6:31523061-31523083 GGCAGGACTGGGTGACTGACAGG - Intergenic
1006411740 6:33877865-33877887 AGCAGACCTGGGGGAGAGGCAGG - Intergenic
1006505592 6:34486674-34486696 GGCAGCCCTGCAGGGGTGACAGG - Intronic
1006716087 6:36121481-36121503 GGCAGCCCTGGGCAAGTGTGAGG + Intergenic
1006830278 6:36964145-36964167 GGCACTCCTGGGGCAGTGCCAGG - Intronic
1006991112 6:38215728-38215750 GGCAGCCCTGGAGGGGTGTGGGG + Intronic
1007820596 6:44558037-44558059 GGCATCCCTGGGGCACGGACTGG + Intergenic
1009359351 6:62793735-62793757 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
1016194567 6:141317906-141317928 GGCAGCTCTGGGAGAGAGAAGGG + Intergenic
1018048765 6:159989244-159989266 AGCAGCCCTGGTGGGGTCACTGG - Intronic
1018923954 6:168193957-168193979 GGCAGCCCCTGGGCAGTGCCTGG - Intergenic
1018988821 6:168658079-168658101 GGGAGGCCTGGGGGACTGATGGG + Intronic
1019013317 6:168860850-168860872 GGCCGCACTGGGTGAGTGTCTGG + Intergenic
1019340497 7:506773-506795 GGCAGCCCTGGGGGAGTGACTGG - Intronic
1019390910 7:786692-786714 GCCAGCCTTGGGGGGGTGTCAGG + Intergenic
1019547581 7:1585895-1585917 GGCAGCCCTGGGGTGGCGGCGGG + Intergenic
1019881406 7:3864652-3864674 GACAGCCCTGGGGATGTGAGGGG + Intronic
1020119438 7:5494957-5494979 GGCAGGCCCACGGGAGTGACTGG + Intronic
1020279556 7:6643346-6643368 GCCAGCCTTGGGGGAGAGCCAGG - Intronic
1021741197 7:23687253-23687275 GGGAGCCTTGGGGGTGTGCCAGG + Intronic
1022794878 7:33724194-33724216 GGCAACCCTCGGGAGGTGACAGG - Intergenic
1023985228 7:45089974-45089996 GGCAGGTCTGGGGGAGTCAGAGG - Intergenic
1026850721 7:73721632-73721654 GGCAGTCCTGGGGAAGGGAAGGG - Intergenic
1027220279 7:76209566-76209588 GGCAGCCCAGTGGGAGTGGTTGG + Intronic
1027544453 7:79509316-79509338 GGCAACCCAGGAGGAGGGACAGG - Intergenic
1028719424 7:94012118-94012140 CGCAGGCCTCGGGGAGTGAGGGG - Intergenic
1029730272 7:102433884-102433906 GGCGTCCCTGGGGGAGGGACAGG + Intronic
1030788594 7:113694931-113694953 GGCCTCCCTGAGGGACTGACTGG + Intergenic
1031586007 7:123533054-123533076 GGCAGGACTGGGGGAGTCAGAGG - Intronic
1032521991 7:132552494-132552516 GGCAGCCCTGGGGGTGGGAATGG + Intronic
1032588387 7:133169645-133169667 GGCTTTCCTGGGGGAGTGCCTGG - Intergenic
1033606724 7:142933063-142933085 GACAGCCAAGGGGGAGTGAAAGG - Intronic
1034434131 7:151055090-151055112 GCCAGCTCTGGGGGATAGACAGG + Exonic
1035018990 7:155789210-155789232 GGCATCCCTGGGGGAGGGAAAGG + Intergenic
1035330982 7:158097261-158097283 GGCAGCACTGGGGTTGTCACAGG + Intronic
1035442011 7:158909924-158909946 GGCAGACCTGGAGGAGTGTGAGG + Intronic
1035872753 8:3153682-3153704 GGCAGCCCTGCAGGAGGGGCTGG + Intronic
1036782600 8:11659732-11659754 GGCACCTTTGGGGAAGTGACAGG + Intergenic
1037887735 8:22603825-22603847 GGCAGCCCTGGGACAGAGAACGG + Exonic
1039966911 8:42290384-42290406 AGCAGCCCTGCTGGAGTCACTGG - Intronic
1040298140 8:46173908-46173930 GGCAGACCTGGGGGAGAAGCAGG + Intergenic
1042217082 8:66437865-66437887 GGCTGCCCAGGGGAACTGACAGG + Intronic
1045876182 8:106983480-106983502 GGCATCCCTGTGGCAGTGATTGG + Intergenic
1046774705 8:118151894-118151916 GGGAGCTCTGGGGGAGTGCTGGG + Intergenic
1047649878 8:126909208-126909230 GGAAGACCTGGGGCAGTGGCAGG + Intergenic
1048580417 8:135725854-135725876 GGTAGCCCAGGGGAAGTGAGGGG - Intergenic
1049105159 8:140608280-140608302 GCCTGCCCTGGGGATGTGACAGG - Intronic
1049290220 8:141797807-141797829 GGCAGCCCTGGGGGCTTGGGCGG + Intergenic
1049381849 8:142320097-142320119 GGCAGCCCAGGGAGAGGGACAGG - Intronic
1049774949 8:144399900-144399922 GGGGACCCTGGGGGAGTGAAGGG + Intronic
1050020879 9:1283516-1283538 GGCACCCCTTGGGAAGAGACAGG + Intergenic
1052993541 9:34536975-34536997 GGCAGCGGCTGGGGAGTGACGGG - Intergenic
1056765849 9:89443922-89443944 GGCAGCCCTGGGCCAGGCACAGG + Intronic
1057272461 9:93658652-93658674 GGAAGGACTGGGGGAGTGGCTGG + Intronic
1057554258 9:96074886-96074908 GGCCACCCTGGTGGAGTGAGTGG - Intergenic
1057864461 9:98667969-98667991 GGCAGCCCAGGGCCAGTGACTGG + Intronic
1059451803 9:114375959-114375981 GGAAGCCCTGGGGTAGAGGCTGG - Intronic
1059451898 9:114376203-114376225 GGGAGCCCTGGGGTAGAGCCTGG - Intronic
1060966274 9:127714033-127714055 GGCAGCTCTGTGGCAGTGGCTGG + Exonic
1061208089 9:129175951-129175973 GGCGGCCCCGGGGGAGGGAGGGG - Exonic
1061318546 9:129813439-129813461 GGCATCCCTGGGGATGTGGCTGG - Exonic
1062001230 9:134216751-134216773 GGAGGCCCTGGGGGAGAGGCTGG - Intergenic
1062261054 9:135663594-135663616 GAGAGGCCTGGGAGAGTGACTGG + Intronic
1062353382 9:136149955-136149977 GGCCACCCTGGAGGAGGGACAGG - Intergenic
1062379568 9:136280764-136280786 GGAAGGCCTGGGGGAGTGGGCGG - Intergenic
1062381373 9:136288420-136288442 GGCAGCCCTGAGGGAGTCCAGGG + Intronic
1062457569 9:136646718-136646740 GGCTGCCCTGGGGGAGTTTGAGG + Intergenic
1062527959 9:136985818-136985840 GGGCGCCCTGGGGGAGGGGCCGG + Intronic
1185483133 X:463131-463153 GGGTGCCCTGGGGAAGTCACCGG - Intergenic
1188127310 X:26384874-26384896 TCCAGCCATGGTGGAGTGACTGG - Intergenic
1188431020 X:30105575-30105597 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
1191090279 X:56613445-56613467 GCCAGCCTTGGAGGACTGACAGG + Intergenic
1191825549 X:65361949-65361971 GGCAGTCCTGGAGGAATGCCTGG - Intergenic
1193818329 X:86130022-86130044 TGCAGCACTGGGAAAGTGACTGG + Intergenic
1195954805 X:110317843-110317865 CGCAGCCCTGGGGGGGAGAGAGG + Exonic
1196025918 X:111041338-111041360 GACAGTCCTGGGGGAGTGTTTGG + Intronic
1196975916 X:121157469-121157491 GGCAGGCCTGAGGCACTGACTGG + Intergenic
1197470958 X:126865336-126865358 GGCAGGCCTGGAGGAATGCCTGG - Intergenic
1198192453 X:134322678-134322700 GGCAGCTCTGGGGCAGTAAAGGG - Intergenic
1199616629 X:149660894-149660916 GGCAGCCCGGGGTGGGTCACAGG + Intergenic
1199626012 X:149742354-149742376 GGCAGCCCGGGGTGGGTCACAGG - Intergenic
1200226564 X:154420818-154420840 GGGTGCCCTGGGAGGGTGACGGG - Intronic
1202585007 Y:26414032-26414054 GGCAGTCCTGTGAGAGTGACAGG - Intergenic