ID: 1019340503

View in Genome Browser
Species Human (GRCh38)
Location 7:506790-506812
Sequence GCTGCCGGTCAGTCACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 99}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340492_1019340503 0 Left 1019340492 7:506767-506789 CCCCGGCCAGTCACTCCCCCAGG 0: 1
1: 0
2: 1
3: 23
4: 298
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340497_1019340503 -6 Left 1019340497 7:506773-506795 CCAGTCACTCCCCCAGGGCTGCC 0: 1
1: 0
2: 1
3: 43
4: 398
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340494_1019340503 -1 Left 1019340494 7:506768-506790 CCCGGCCAGTCACTCCCCCAGGG 0: 1
1: 0
2: 2
3: 34
4: 311
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340491_1019340503 11 Left 1019340491 7:506756-506778 CCAGCTAGGGACCCCGGCCAGTC 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340496_1019340503 -2 Left 1019340496 7:506769-506791 CCGGCCAGTCACTCCCCCAGGGC 0: 1
1: 0
2: 4
3: 46
4: 361
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340490_1019340503 12 Left 1019340490 7:506755-506777 CCCAGCTAGGGACCCCGGCCAGT 0: 1
1: 0
2: 1
3: 12
4: 133
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340489_1019340503 15 Left 1019340489 7:506752-506774 CCACCCAGCTAGGGACCCCGGCC 0: 1
1: 0
2: 0
3: 28
4: 283
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99
1019340488_1019340503 16 Left 1019340488 7:506751-506773 CCCACCCAGCTAGGGACCCCGGC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG 0: 1
1: 0
2: 1
3: 3
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340503 Original CRISPR GCTGCCGGTCAGTCACATCC TGG Intronic
902367384 1:15985702-15985724 GCTTCCGGGAAGTCACATCATGG + Intergenic
912379724 1:109240793-109240815 TCTGCCTGTCAGACTCATCCTGG - Intergenic
915302963 1:154961971-154961993 GCTGCCGGACCGTACCATCCCGG + Intronic
917060973 1:171038988-171039010 GCTGATGGTCAGCTACATCCGGG - Intronic
917968653 1:180193940-180193962 GGTGCCTGTCACTCACACCCAGG - Intronic
919807018 1:201386262-201386284 ACTGCCGGCCAGTCCCACCCAGG - Intronic
1063362658 10:5470351-5470373 GCTGCTGCTCTGTCACCTCCAGG - Intergenic
1067224361 10:44365841-44365863 GCTGCCAGTCAGCCCCATGCTGG - Intergenic
1067805018 10:49386339-49386361 GCCTCCTGTCAGTCACAGCCAGG - Intronic
1072230552 10:93410832-93410854 CCTGTCAGTCATTCACATCCTGG + Intronic
1076736360 10:132460936-132460958 GCTGCAGGTCAGGCAGAGCCTGG - Intergenic
1077350073 11:2089037-2089059 GCAGCCGGGCAGTCAGAGCCAGG + Intergenic
1078017811 11:7630254-7630276 GTGACCAGTCAGTCACATCCTGG - Intronic
1079571123 11:21944559-21944581 GCTTCAGGTCAGTCAGATCCAGG + Intergenic
1082106561 11:48227825-48227847 GCTGCCTGTCTGTCACCTTCTGG + Intergenic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1084697103 11:70762353-70762375 GCTGTCGGTTAGTGGCATCCAGG + Intronic
1084815383 11:71642809-71642831 GCTGTGGGTCAGACACACCCTGG - Intergenic
1092427632 12:8387240-8387262 GCTGTGGGTCAGACACACCCTGG + Intergenic
1092428898 12:8394221-8394243 GCTGTGGGTCAGACACACCCTGG + Intergenic
1098280268 12:68855331-68855353 GGTACCTGTGAGTCACATCCAGG + Exonic
1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG + Intronic
1107300192 13:38958056-38958078 GCAGCCCAGCAGTCACATCCTGG + Intergenic
1112692682 13:101915830-101915852 GCAGCCCTTCAGTCAAATCCTGG - Intronic
1113682292 13:112252994-112253016 CGTGCCGGGCAGTCACAACCCGG - Intergenic
1118178414 14:63465820-63465842 GCTGACTCTCAGGCACATCCTGG - Intronic
1119427617 14:74546068-74546090 GCTTCCCTTCAGTCACATTCTGG - Intronic
1119732255 14:76958356-76958378 GCTGCCAGTCAGGCACTCCCTGG + Intergenic
1121567335 14:94919984-94920006 GCTGCCTGCCAGCCACATCTTGG - Intergenic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1129153823 15:73705145-73705167 GCCTCTGGTCAGTCACTTCCTGG + Intronic
1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG + Intergenic
1132760738 16:1507447-1507469 GCTGCCTGTCAGCCACCTCGAGG - Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132897536 16:2236198-2236220 GTAGACGGTCAGCCACATCCCGG - Exonic
1133370616 16:5243138-5243160 GCTGTGGGTCAGACACACCCTGG - Intergenic
1134194381 16:12147822-12147844 CCTGCAGGGCATTCACATCCTGG - Intronic
1134662931 16:15997770-15997792 CCTGCCGGTAAGGAACATCCAGG + Intronic
1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG + Intronic
1139305782 16:65985076-65985098 TCTGGCAGTCAGTCACATTCTGG + Intergenic
1140031888 16:71345550-71345572 TCTGAAGGTCAGTCACAGCCCGG - Intergenic
1143110516 17:4550266-4550288 GCTGCCGCTCAGGGTCATCCTGG + Exonic
1154449035 18:14459823-14459845 TCTGCCGCTCAGCCCCATCCTGG + Intergenic
1163112588 19:15170464-15170486 GCTGCTGGTCATTCTCGTCCTGG - Exonic
1166867957 19:45852466-45852488 TCTGTCAGTCACTCACATCCAGG + Exonic
1168169658 19:54576921-54576943 GCTTTGGGGCAGTCACATCCAGG - Intronic
929423722 2:41821442-41821464 TTTCCCAGTCAGTCACATCCTGG + Intergenic
932242042 2:70164771-70164793 GCTGCCTGCCAGTCAAATCTAGG + Intronic
934954603 2:98607256-98607278 GCTGCCGTTCAGCCAGCTCCTGG - Intronic
936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG + Intronic
940293559 2:152099617-152099639 GCTGCGAGTCACACACATCCAGG + Intergenic
1181518340 22:23430891-23430913 GCTTCCTGGCAGTCACACCCTGG - Intergenic
1181577373 22:23803499-23803521 GCTGCCTGTCAGGCAGATTCTGG + Intronic
1182145787 22:27995989-27996011 GAAGCCGGTCAGTGCCATCCTGG + Intronic
1182444766 22:30383587-30383609 TCTGCTGGGCAGTCACGTCCCGG - Intronic
1184823855 22:46933648-46933670 GCTGCCGGCCAGTGCCACCCTGG - Intronic
1185125375 22:49007549-49007571 TCTGCCGGCCTCTCACATCCAGG - Intergenic
951228986 3:20155005-20155027 GCAGCTGGTCAATCACATTCTGG - Intergenic
954139607 3:48598144-48598166 GCTGCCTGGCAGTCACAAGCAGG - Intergenic
957072329 3:75576934-75576956 GCTGTGGGTCAGACACACCCTGG + Intergenic
959428354 3:106221018-106221040 GCTGTGAGTCTGTCACATCCTGG + Intergenic
961281740 3:125769837-125769859 GCTGTGGGTCAGACACACCCTGG - Intergenic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
961872605 3:129999747-129999769 GCTGTGGGTCAGACACACCCTGG + Intergenic
967601555 3:191396265-191396287 GCTGACTGTCAGTCACATAAAGG - Intronic
968178063 3:196568605-196568627 GCAGCCAAACAGTCACATCCGGG + Exonic
969576463 4:8038895-8038917 GCTCCCAGTCACTCACAGCCTGG + Intronic
969738030 4:9004103-9004125 GCTGTGGGTCAGACACACCCTGG - Intergenic
969797220 4:9535650-9535672 GCTGTGGGTCAGACACACCCTGG - Intergenic
973705945 4:53580458-53580480 GCTGTCTGGCAGTCACATCAAGG - Intronic
988943125 5:36166570-36166592 GCAACCGACCAGTCACATCCGGG - Exonic
990818794 5:59814502-59814524 CCTGCCAGTGAGTCACATGCAGG + Intronic
992266958 5:75028948-75028970 TCTGCAGATCAGACACATCCTGG + Exonic
992782493 5:80140852-80140874 GCTGCTGGTCAGACACATTTAGG - Exonic
994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG + Intronic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1010629496 6:78180539-78180561 GCTGCCTACCAGTCACATACTGG + Intergenic
1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG + Intergenic
1011281051 6:85678431-85678453 GCCGCCGCTCAGGCACATGCCGG + Intergenic
1013709642 6:112881300-112881322 GCCGCCTGTCAGTCACACCCTGG - Intergenic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019994541 7:4715652-4715674 CCTGCCAGTCAGTCACAGCAGGG - Intronic
1023232553 7:38050060-38050082 GCTGCCTGCCAGTCCCATGCAGG - Intergenic
1026341558 7:69438642-69438664 GCTGCCTGACACTCACATGCAGG + Intergenic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1036243114 8:7095377-7095399 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036358540 8:8061845-8061867 GCTGTGGGTCAGACACACCCTGG - Intergenic
1036891157 8:12598114-12598136 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036898713 8:12656054-12656076 GCTGTGGGTCAGACACACCCTGG + Intergenic
1036899964 8:12663083-12663105 GCTGTGGGTCAGACACACCCTGG + Intergenic
1038612847 8:29070686-29070708 GCTGCTGGTCAGGCCCAGCCGGG - Exonic
1045305352 8:100952527-100952549 GCTCCCGTTCAGCAACATCCGGG + Intronic
1049530657 8:143153230-143153252 TCTGCCGGGGAGGCACATCCAGG + Intergenic
1050182445 9:2935091-2935113 GCTGCCGGACAGGCAGCTCCAGG - Intergenic
1051227799 9:14920950-14920972 TTTCCCAGTCAGTCACATCCTGG - Intergenic
1054417423 9:64890158-64890180 ACTGCAGCTCAGTCCCATCCAGG - Intergenic
1061007483 9:127936391-127936413 GCTGCCAGTCAGTAACCTCTGGG - Intronic
1200052477 X:153442338-153442360 CCTGCCTGTCTGTCCCATCCTGG + Intergenic
1200919083 Y:8597129-8597151 GGTGCCAGGCAGTCCCATCCAGG - Intergenic