ID: 1019340653

View in Genome Browser
Species Human (GRCh38)
Location 7:507389-507411
Sequence AAAGCAGGGGCCACTCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019340644_1019340653 20 Left 1019340644 7:507346-507368 CCAGAGGGAGAGCCCTGGTCCTG 0: 1
1: 0
2: 2
3: 20
4: 234
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data
1019340647_1019340653 7 Left 1019340647 7:507359-507381 CCTGGTCCTGGCTCTACCACTGC 0: 1
1: 0
2: 2
3: 57
4: 419
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data
1019340643_1019340653 21 Left 1019340643 7:507345-507367 CCCAGAGGGAGAGCCCTGGTCCT 0: 1
1: 0
2: 4
3: 17
4: 214
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data
1019340650_1019340653 -9 Left 1019340650 7:507375-507397 CCACTGCACAGAGCAAAGCAGGG 0: 1
1: 0
2: 1
3: 43
4: 336
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data
1019340646_1019340653 8 Left 1019340646 7:507358-507380 CCCTGGTCCTGGCTCTACCACTG 0: 1
1: 0
2: 4
3: 41
4: 382
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data
1019340648_1019340653 1 Left 1019340648 7:507365-507387 CCTGGCTCTACCACTGCACAGAG 0: 1
1: 0
2: 1
3: 31
4: 264
Right 1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019340653 Original CRISPR AAAGCAGGGGCCACTCCCAG CGG Intronic
No off target data available for this crispr